ID: 1164648157

View in Genome Browser
Species Human (GRCh38)
Location 19:29873792-29873814
Sequence CAACAGCCTCTGGCTTTGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164648148_1164648157 3 Left 1164648148 19:29873766-29873788 CCCGCGCCGCTCTCCCGGGAAGT No data
Right 1164648157 19:29873792-29873814 CAACAGCCTCTGGCTTTGCTCGG No data
1164648149_1164648157 2 Left 1164648149 19:29873767-29873789 CCGCGCCGCTCTCCCGGGAAGTC No data
Right 1164648157 19:29873792-29873814 CAACAGCCTCTGGCTTTGCTCGG No data
1164648139_1164648157 18 Left 1164648139 19:29873751-29873773 CCCCGCGCCCCCGCGCCCGCGCC No data
Right 1164648157 19:29873792-29873814 CAACAGCCTCTGGCTTTGCTCGG No data
1164648142_1164648157 11 Left 1164648142 19:29873758-29873780 CCCCCGCGCCCGCGCCGCTCTCC No data
Right 1164648157 19:29873792-29873814 CAACAGCCTCTGGCTTTGCTCGG No data
1164648144_1164648157 9 Left 1164648144 19:29873760-29873782 CCCGCGCCCGCGCCGCTCTCCCG No data
Right 1164648157 19:29873792-29873814 CAACAGCCTCTGGCTTTGCTCGG No data
1164648143_1164648157 10 Left 1164648143 19:29873759-29873781 CCCCGCGCCCGCGCCGCTCTCCC No data
Right 1164648157 19:29873792-29873814 CAACAGCCTCTGGCTTTGCTCGG No data
1164648134_1164648157 30 Left 1164648134 19:29873739-29873761 CCCACCCAGCGCCCCCGCGCCCC No data
Right 1164648157 19:29873792-29873814 CAACAGCCTCTGGCTTTGCTCGG No data
1164648136_1164648157 26 Left 1164648136 19:29873743-29873765 CCCAGCGCCCCCGCGCCCCCGCG No data
Right 1164648157 19:29873792-29873814 CAACAGCCTCTGGCTTTGCTCGG No data
1164648135_1164648157 29 Left 1164648135 19:29873740-29873762 CCACCCAGCGCCCCCGCGCCCCC No data
Right 1164648157 19:29873792-29873814 CAACAGCCTCTGGCTTTGCTCGG No data
1164648138_1164648157 19 Left 1164648138 19:29873750-29873772 CCCCCGCGCCCCCGCGCCCGCGC No data
Right 1164648157 19:29873792-29873814 CAACAGCCTCTGGCTTTGCTCGG No data
1164648151_1164648157 -10 Left 1164648151 19:29873779-29873801 CCCGGGAAGTCCCCAACAGCCTC No data
Right 1164648157 19:29873792-29873814 CAACAGCCTCTGGCTTTGCTCGG No data
1164648140_1164648157 17 Left 1164648140 19:29873752-29873774 CCCGCGCCCCCGCGCCCGCGCCG No data
Right 1164648157 19:29873792-29873814 CAACAGCCTCTGGCTTTGCTCGG No data
1164648145_1164648157 8 Left 1164648145 19:29873761-29873783 CCGCGCCCGCGCCGCTCTCCCGG No data
Right 1164648157 19:29873792-29873814 CAACAGCCTCTGGCTTTGCTCGG No data
1164648137_1164648157 25 Left 1164648137 19:29873744-29873766 CCAGCGCCCCCGCGCCCCCGCGC No data
Right 1164648157 19:29873792-29873814 CAACAGCCTCTGGCTTTGCTCGG No data
1164648141_1164648157 16 Left 1164648141 19:29873753-29873775 CCGCGCCCCCGCGCCCGCGCCGC No data
Right 1164648157 19:29873792-29873814 CAACAGCCTCTGGCTTTGCTCGG No data
1164648150_1164648157 -3 Left 1164648150 19:29873772-29873794 CCGCTCTCCCGGGAAGTCCCCAA No data
Right 1164648157 19:29873792-29873814 CAACAGCCTCTGGCTTTGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164648157 Original CRISPR CAACAGCCTCTGGCTTTGCT CGG Intergenic