ID: 1164649667

View in Genome Browser
Species Human (GRCh38)
Location 19:29882759-29882781
Sequence GGCCCTTTCTCCCCACCAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164649667_1164649670 -7 Left 1164649667 19:29882759-29882781 CCCGCTGGTGGGGAGAAAGGGCC No data
Right 1164649670 19:29882775-29882797 AAGGGCCTTGCTTGGTCTCATGG No data
1164649667_1164649675 15 Left 1164649667 19:29882759-29882781 CCCGCTGGTGGGGAGAAAGGGCC No data
Right 1164649675 19:29882797-29882819 GACCAGCCAGGCAGGCAAGGAGG No data
1164649667_1164649678 28 Left 1164649667 19:29882759-29882781 CCCGCTGGTGGGGAGAAAGGGCC No data
Right 1164649678 19:29882810-29882832 GGCAAGGAGGCCGCAAACACAGG No data
1164649667_1164649674 12 Left 1164649667 19:29882759-29882781 CCCGCTGGTGGGGAGAAAGGGCC No data
Right 1164649674 19:29882794-29882816 ATGGACCAGCCAGGCAGGCAAGG No data
1164649667_1164649673 7 Left 1164649667 19:29882759-29882781 CCCGCTGGTGGGGAGAAAGGGCC No data
Right 1164649673 19:29882789-29882811 GTCTCATGGACCAGCCAGGCAGG No data
1164649667_1164649672 3 Left 1164649667 19:29882759-29882781 CCCGCTGGTGGGGAGAAAGGGCC No data
Right 1164649672 19:29882785-29882807 CTTGGTCTCATGGACCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164649667 Original CRISPR GGCCCTTTCTCCCCACCAGC GGG (reversed) Intergenic