ID: 1164649670

View in Genome Browser
Species Human (GRCh38)
Location 19:29882775-29882797
Sequence AAGGGCCTTGCTTGGTCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164649655_1164649670 24 Left 1164649655 19:29882728-29882750 CCTTTGCCATCCCTCCGGTGGCA No data
Right 1164649670 19:29882775-29882797 AAGGGCCTTGCTTGGTCTCATGG No data
1164649658_1164649670 13 Left 1164649658 19:29882739-29882761 CCTCCGGTGGCAGCATGTTCCCC No data
Right 1164649670 19:29882775-29882797 AAGGGCCTTGCTTGGTCTCATGG No data
1164649666_1164649670 -6 Left 1164649666 19:29882758-29882780 CCCCGCTGGTGGGGAGAAAGGGC No data
Right 1164649670 19:29882775-29882797 AAGGGCCTTGCTTGGTCTCATGG No data
1164649668_1164649670 -8 Left 1164649668 19:29882760-29882782 CCGCTGGTGGGGAGAAAGGGCCT No data
Right 1164649670 19:29882775-29882797 AAGGGCCTTGCTTGGTCTCATGG No data
1164649654_1164649670 25 Left 1164649654 19:29882727-29882749 CCCTTTGCCATCCCTCCGGTGGC No data
Right 1164649670 19:29882775-29882797 AAGGGCCTTGCTTGGTCTCATGG No data
1164649667_1164649670 -7 Left 1164649667 19:29882759-29882781 CCCGCTGGTGGGGAGAAAGGGCC No data
Right 1164649670 19:29882775-29882797 AAGGGCCTTGCTTGGTCTCATGG No data
1164649656_1164649670 18 Left 1164649656 19:29882734-29882756 CCATCCCTCCGGTGGCAGCATGT No data
Right 1164649670 19:29882775-29882797 AAGGGCCTTGCTTGGTCTCATGG No data
1164649659_1164649670 10 Left 1164649659 19:29882742-29882764 CCGGTGGCAGCATGTTCCCCGCT No data
Right 1164649670 19:29882775-29882797 AAGGGCCTTGCTTGGTCTCATGG No data
1164649657_1164649670 14 Left 1164649657 19:29882738-29882760 CCCTCCGGTGGCAGCATGTTCCC No data
Right 1164649670 19:29882775-29882797 AAGGGCCTTGCTTGGTCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164649670 Original CRISPR AAGGGCCTTGCTTGGTCTCA TGG Intergenic