ID: 1164649671

View in Genome Browser
Species Human (GRCh38)
Location 19:29882780-29882802
Sequence CTGGTCCATGAGACCAAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164649671_1164649678 7 Left 1164649671 19:29882780-29882802 CCTTGCTTGGTCTCATGGACCAG No data
Right 1164649678 19:29882810-29882832 GGCAAGGAGGCCGCAAACACAGG No data
1164649671_1164649674 -9 Left 1164649671 19:29882780-29882802 CCTTGCTTGGTCTCATGGACCAG No data
Right 1164649674 19:29882794-29882816 ATGGACCAGCCAGGCAGGCAAGG No data
1164649671_1164649675 -6 Left 1164649671 19:29882780-29882802 CCTTGCTTGGTCTCATGGACCAG No data
Right 1164649675 19:29882797-29882819 GACCAGCCAGGCAGGCAAGGAGG No data
1164649671_1164649680 26 Left 1164649671 19:29882780-29882802 CCTTGCTTGGTCTCATGGACCAG No data
Right 1164649680 19:29882829-29882851 CAGGACTAATAGCACCCTCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164649671 Original CRISPR CTGGTCCATGAGACCAAGCA AGG (reversed) Intergenic