ID: 1164649673

View in Genome Browser
Species Human (GRCh38)
Location 19:29882789-29882811
Sequence GTCTCATGGACCAGCCAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164649668_1164649673 6 Left 1164649668 19:29882760-29882782 CCGCTGGTGGGGAGAAAGGGCCT No data
Right 1164649673 19:29882789-29882811 GTCTCATGGACCAGCCAGGCAGG No data
1164649666_1164649673 8 Left 1164649666 19:29882758-29882780 CCCCGCTGGTGGGGAGAAAGGGC No data
Right 1164649673 19:29882789-29882811 GTCTCATGGACCAGCCAGGCAGG No data
1164649667_1164649673 7 Left 1164649667 19:29882759-29882781 CCCGCTGGTGGGGAGAAAGGGCC No data
Right 1164649673 19:29882789-29882811 GTCTCATGGACCAGCCAGGCAGG No data
1164649657_1164649673 28 Left 1164649657 19:29882738-29882760 CCCTCCGGTGGCAGCATGTTCCC No data
Right 1164649673 19:29882789-29882811 GTCTCATGGACCAGCCAGGCAGG No data
1164649659_1164649673 24 Left 1164649659 19:29882742-29882764 CCGGTGGCAGCATGTTCCCCGCT No data
Right 1164649673 19:29882789-29882811 GTCTCATGGACCAGCCAGGCAGG No data
1164649658_1164649673 27 Left 1164649658 19:29882739-29882761 CCTCCGGTGGCAGCATGTTCCCC No data
Right 1164649673 19:29882789-29882811 GTCTCATGGACCAGCCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164649673 Original CRISPR GTCTCATGGACCAGCCAGGC AGG Intergenic