ID: 1164649675

View in Genome Browser
Species Human (GRCh38)
Location 19:29882797-29882819
Sequence GACCAGCCAGGCAGGCAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164649671_1164649675 -6 Left 1164649671 19:29882780-29882802 CCTTGCTTGGTCTCATGGACCAG No data
Right 1164649675 19:29882797-29882819 GACCAGCCAGGCAGGCAAGGAGG No data
1164649668_1164649675 14 Left 1164649668 19:29882760-29882782 CCGCTGGTGGGGAGAAAGGGCCT No data
Right 1164649675 19:29882797-29882819 GACCAGCCAGGCAGGCAAGGAGG No data
1164649667_1164649675 15 Left 1164649667 19:29882759-29882781 CCCGCTGGTGGGGAGAAAGGGCC No data
Right 1164649675 19:29882797-29882819 GACCAGCCAGGCAGGCAAGGAGG No data
1164649666_1164649675 16 Left 1164649666 19:29882758-29882780 CCCCGCTGGTGGGGAGAAAGGGC No data
Right 1164649675 19:29882797-29882819 GACCAGCCAGGCAGGCAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164649675 Original CRISPR GACCAGCCAGGCAGGCAAGG AGG Intergenic