ID: 1164658520

View in Genome Browser
Species Human (GRCh38)
Location 19:29942255-29942277
Sequence CCCAGCCAGGCGTCGCGTGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 137}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164658520_1164658531 11 Left 1164658520 19:29942255-29942277 CCGCCACGCGACGCCTGGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 137
Right 1164658531 19:29942289-29942311 GAGGCGTCTCGGTACCTGGCAGG 0: 1
1: 0
2: 1
3: 1
4: 72
1164658520_1164658530 7 Left 1164658520 19:29942255-29942277 CCGCCACGCGACGCCTGGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 137
Right 1164658530 19:29942285-29942307 CGGAGAGGCGTCTCGGTACCTGG 0: 1
1: 0
2: 0
3: 4
4: 44
1164658520_1164658527 0 Left 1164658520 19:29942255-29942277 CCGCCACGCGACGCCTGGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 137
Right 1164658527 19:29942278-29942300 CCCGCACCGGAGAGGCGTCTCGG 0: 1
1: 0
2: 0
3: 5
4: 38
1164658520_1164658534 26 Left 1164658520 19:29942255-29942277 CCGCCACGCGACGCCTGGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 137
Right 1164658534 19:29942304-29942326 CTGGCAGGCGGCCTGCTACTCGG 0: 1
1: 0
2: 1
3: 13
4: 129
1164658520_1164658532 14 Left 1164658520 19:29942255-29942277 CCGCCACGCGACGCCTGGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 137
Right 1164658532 19:29942292-29942314 GCGTCTCGGTACCTGGCAGGCGG 0: 1
1: 0
2: 0
3: 3
4: 67
1164658520_1164658525 -8 Left 1164658520 19:29942255-29942277 CCGCCACGCGACGCCTGGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 137
Right 1164658525 19:29942270-29942292 TGGCTGGGCCCGCACCGGAGAGG 0: 1
1: 0
2: 1
3: 11
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164658520 Original CRISPR CCCAGCCAGGCGTCGCGTGG CGG (reversed) Exonic