ID: 1164658520

View in Genome Browser
Species Human (GRCh38)
Location 19:29942255-29942277
Sequence CCCAGCCAGGCGTCGCGTGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 137}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164658520_1164658531 11 Left 1164658520 19:29942255-29942277 CCGCCACGCGACGCCTGGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 137
Right 1164658531 19:29942289-29942311 GAGGCGTCTCGGTACCTGGCAGG 0: 1
1: 0
2: 1
3: 1
4: 72
1164658520_1164658525 -8 Left 1164658520 19:29942255-29942277 CCGCCACGCGACGCCTGGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 137
Right 1164658525 19:29942270-29942292 TGGCTGGGCCCGCACCGGAGAGG 0: 1
1: 0
2: 1
3: 11
4: 127
1164658520_1164658534 26 Left 1164658520 19:29942255-29942277 CCGCCACGCGACGCCTGGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 137
Right 1164658534 19:29942304-29942326 CTGGCAGGCGGCCTGCTACTCGG 0: 1
1: 0
2: 1
3: 13
4: 129
1164658520_1164658527 0 Left 1164658520 19:29942255-29942277 CCGCCACGCGACGCCTGGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 137
Right 1164658527 19:29942278-29942300 CCCGCACCGGAGAGGCGTCTCGG 0: 1
1: 0
2: 0
3: 5
4: 38
1164658520_1164658532 14 Left 1164658520 19:29942255-29942277 CCGCCACGCGACGCCTGGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 137
Right 1164658532 19:29942292-29942314 GCGTCTCGGTACCTGGCAGGCGG 0: 1
1: 0
2: 0
3: 3
4: 67
1164658520_1164658530 7 Left 1164658520 19:29942255-29942277 CCGCCACGCGACGCCTGGCTGGG 0: 1
1: 0
2: 0
3: 8
4: 137
Right 1164658530 19:29942285-29942307 CGGAGAGGCGTCTCGGTACCTGG 0: 1
1: 0
2: 0
3: 4
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164658520 Original CRISPR CCCAGCCAGGCGTCGCGTGG CGG (reversed) Exonic
902290025 1:15429392-15429414 CCCAGCCAGGCAGGGTGTGGGGG + Exonic
905298799 1:36972103-36972125 CCCAGCCAGGCCACACGCGGAGG + Intronic
906500771 1:46340645-46340667 CCCAGCCAGGAGTCCCCTGAAGG - Exonic
906742064 1:48192798-48192820 CCCAGCCAGCCGCCCCGTCGGGG + Intergenic
907197446 1:52698184-52698206 CGCAGCCCGGCGACGCGTCGGGG - Intronic
907411631 1:54287544-54287566 ACCAGACAGGCGTCACTTGGAGG - Intronic
915525849 1:156475835-156475857 CCCAGCCAGGAGTGGGGCGGGGG - Intronic
917481975 1:175419983-175420005 CCCAGAGAGGCGTGGTGTGGAGG + Intronic
919645917 1:200094470-200094492 CCCATCCAGGCTGGGCGTGGTGG - Intronic
1064244327 10:13657163-13657185 CCCAACCTGGCGGCGCGCGGGGG - Exonic
1069705737 10:70458334-70458356 CCCGGCCAGGCGCGGCGGGGCGG - Intergenic
1069837896 10:71320610-71320632 CCCAGCCTGGATTCGCATGGAGG - Intronic
1072913524 10:99523159-99523181 CCCACCCAGGCGTGGAGCGGAGG + Intergenic
1074105268 10:110384543-110384565 CCCAGCCTGGCCAGGCGTGGTGG - Intergenic
1075048622 10:119165671-119165693 CGCCGCCAGGCCGCGCGTGGAGG + Intergenic
1075125348 10:119694782-119694804 GCAAGCCAGGCGTGGAGTGGCGG + Intergenic
1075399029 10:122148472-122148494 ACCAGCCAGGCATCGCCTGTTGG + Intronic
1076777870 10:132708079-132708101 CCCAGCCTGGGGTGGGGTGGGGG - Intronic
1077408764 11:2393993-2394015 CCCAGCTGGGCGGCCCGTGGTGG + Intronic
1084189393 11:67492109-67492131 CCCAGCCAGGCGGAGCGTGAGGG - Exonic
1084975076 11:72792614-72792636 CCCAGCCAGGTGAAGCGAGGTGG - Intronic
1085080144 11:73627225-73627247 CCCAGCCTGGAGTGGAGTGGTGG - Intergenic
1085474819 11:76783256-76783278 CCCTGCCGGGCGCCGGGTGGCGG - Intronic
1085754513 11:79191963-79191985 CCCAGCCAGCCGCCCCGTCGGGG + Intronic
1085754546 11:79192061-79192083 CCCAGCCAGCCGTCCCGTCCGGG + Intronic
1086049787 11:82576965-82576987 CCCACCCAGGAGTGGCCTGGAGG + Intergenic
1093585575 12:20831312-20831334 CCCAGCCTGGAGTGGAGTGGTGG - Intronic
1096264662 12:50113344-50113366 CCCAGGCTGGGGTCCCGTGGCGG + Intronic
1096716199 12:53493026-53493048 CCCAGCCACGCGCCACGTGACGG - Intronic
1101883822 12:108644345-108644367 GTCAGCCAGGAGACGCGTGGTGG - Intergenic
1103682908 12:122708855-122708877 CCCAGCCAGCCGCCCCGTCGGGG - Intergenic
1103971592 12:124675953-124675975 CCCAGCCATCCGTGGCCTGGTGG - Intergenic
1115096956 14:29648939-29648961 CCCAGCCAGGCCGGGCATGGTGG - Intronic
1115474676 14:33801128-33801150 CCCGGCCAGGCCCCGCTTGGAGG + Intronic
1117029165 14:51651678-51651700 CCCAACCAAGCGTCCCGCGGAGG - Intronic
1119780035 14:77271205-77271227 CCAGCCCAGGCGTCGCGGGGTGG - Exonic
1121535804 14:94690001-94690023 CCCAGCCAGGCAGCACCTGGAGG + Intergenic
1122773407 14:104106924-104106946 CCCAGCCACGCCTGGCCTGGGGG + Intronic
1129322245 15:74781930-74781952 CGCAGCCAGGCGGCAAGTGGGGG + Intergenic
1132889308 16:2196255-2196277 CCCCGCCCGGCGCCGGGTGGGGG + Intronic
1132968565 16:2673466-2673488 TCCTGCCTGGCGTCGCGCGGGGG - Intergenic
1134395146 16:13855592-13855614 CTCAGCCAGGCTTTGCGGGGTGG + Intergenic
1136098505 16:27975985-27976007 CCCAGACAGGCCAGGCGTGGTGG + Intronic
1137558915 16:49490558-49490580 CCCAGCCTAGGGCCGCGTGGGGG - Exonic
1137589920 16:49687191-49687213 CCCAGCCAGGGGTCTCTTGGTGG - Intronic
1138588421 16:57986038-57986060 CCCAGCGAGGCCTGGCGAGGAGG + Intronic
1140994181 16:80243536-80243558 CCCATCCAGGAGTGACGTGGGGG + Intergenic
1141278579 16:82609727-82609749 CCCAGCTAGGCCAGGCGTGGTGG + Intergenic
1141499890 16:84436663-84436685 CTCAGCCTGGCCTCGGGTGGAGG + Intronic
1141699061 16:85634141-85634163 GCCCGCCAGGCTGCGCGTGGGGG + Intronic
1141763483 16:86044156-86044178 CCCAGCCACGCACCCCGTGGTGG + Intergenic
1143868722 17:9942798-9942820 TCCAGCCAAGTGTCGCGTGAGGG + Intronic
1144586873 17:16492322-16492344 CCCAGCCCGGAGCCGCGGGGCGG - Intergenic
1144735662 17:17553954-17553976 CCCAGCCAGGGGTGGGGTGGGGG + Intronic
1145115928 17:20210845-20210867 CCCGGCCAGGCCTGGCATGGAGG - Intronic
1151903971 17:77035766-77035788 CCCAGCCAGGCTTTGCTTTGGGG + Intergenic
1152610782 17:81314148-81314170 CCCATCCAGGCCTCCTGTGGGGG + Intronic
1163311979 19:16520294-16520316 AGCAGCCAGGCGTCGTGGGGAGG + Exonic
1164658520 19:29942255-29942277 CCCAGCCAGGCGTCGCGTGGCGG - Exonic
1166924899 19:46260737-46260759 CCCAGCCGGGGGTCCCCTGGGGG + Intergenic
926434414 2:12823914-12823936 CCCAGCCAGGCCTCACGGTGAGG - Intergenic
928003379 2:27541240-27541262 ACCAGTCAGGCGTGGCGTGGCGG + Intronic
929044339 2:37775571-37775593 CTCAGCCTGGCGGCGGGTGGGGG - Intergenic
932257743 2:70301837-70301859 CAGTGCAAGGCGTCGCGTGGTGG + Intronic
932420917 2:71600874-71600896 CCCAGGCAGGAGTGGGGTGGGGG + Intronic
932807404 2:74795915-74795937 CCCAGCCAGCCGTCCCGTTCGGG - Intergenic
935789995 2:106582200-106582222 CCCTGCCATGCGTGGGGTGGAGG - Intergenic
935872819 2:107469555-107469577 CCCAGCCCTGCCTCGCGGGGAGG + Intergenic
937992212 2:127670832-127670854 CCCAGCGAGGAGTCTGGTGGGGG - Intronic
938066647 2:128285226-128285248 CCCAGCCAGGGGTCTGGTGGAGG + Intronic
938127830 2:128687131-128687153 CCCAGCCAGGGGAGGCTTGGGGG + Intergenic
942316522 2:174701514-174701536 CACAGCCAGGCCAGGCGTGGTGG + Intergenic
944221880 2:197310992-197311014 CCCGGCCGGGCGCCGCGTGCAGG - Intronic
947085014 2:226441456-226441478 CCCAGTTAGGCCTGGCGTGGTGG + Intergenic
947566664 2:231198598-231198620 GCCACCCCGGCGTCACGTGGGGG - Exonic
947668881 2:231924622-231924644 CCCTGCCGGGTGCCGCGTGGTGG - Intronic
948248699 2:236507646-236507668 CCCACCCAGGCCTCCCGCGGTGG - Intergenic
948462879 2:238138810-238138832 CCCAGCCAGGAGCAGCGGGGAGG + Intronic
1169166476 20:3428630-3428652 CCCAACCAGGCCGGGCGTGGTGG + Intergenic
1172650854 20:36500431-36500453 TCGAGCCAGGGGTCGGGTGGGGG - Exonic
1176168383 20:63686216-63686238 CCCGGCCAGGCGCTGCGTGGAGG - Intronic
1176194401 20:63830836-63830858 CCCAGGCCGGCGGCGCGGGGCGG - Intronic
1178707871 21:34889672-34889694 CCCACCCCGGCTTCGCGTGCGGG + Intronic
1181745756 22:24953765-24953787 GCCACCTAGGCGTCGCGCGGTGG - Intronic
1181949812 22:26545790-26545812 CTCAGCCAGGCCTGGGGTGGTGG + Intronic
1182094104 22:27614607-27614629 CCCACCCCGGGGTCGGGTGGTGG - Intergenic
1182590119 22:31372826-31372848 CACAGCCAGGCTAGGCGTGGTGG - Intergenic
1183355016 22:37353757-37353779 CCCAGCCAGGCTTGGCCAGGAGG + Intergenic
1183407800 22:37639163-37639185 CCCAGCCAGTCATCCAGTGGTGG + Intronic
1184827237 22:46960657-46960679 CCAGGCCAGGCGCGGCGTGGTGG + Intronic
1185056135 22:48579257-48579279 CCCAGCCAGGCCTGGTGCGGTGG - Intronic
950636348 3:14317856-14317878 ACCAGCCAGGCGATGAGTGGGGG + Intergenic
952302316 3:32114140-32114162 CCCAGCCAGGCTGGGTGTGGTGG - Intronic
954377940 3:50204827-50204849 CCCAACCAGGGGTGGGGTGGGGG - Intergenic
956422712 3:69101363-69101385 CCCAGCCAGGAGTGCAGTGGGGG + Intronic
968565711 4:1311563-1311585 CCCGGCCTGGCCTCGTGTGGTGG + Intronic
968659803 4:1794259-1794281 CCCAGCCTGGCTCCCCGTGGTGG - Intronic
982850556 4:160309769-160309791 CCCAGCCAGGAGTGCAGTGGCGG - Intergenic
984533471 4:180944878-180944900 CCCAGCCAGCCGCCCCGTCGGGG + Intergenic
985632018 5:1018733-1018755 CCCTGCCAGGCCTTGCTTGGAGG + Intronic
987088186 5:14488170-14488192 CCTTGCCAGGGGCCGCGTGGCGG - Exonic
987089097 5:14495532-14495554 CCCAGCCAGGCCAGGCGTAGTGG + Intronic
994620368 5:102155168-102155190 CCCAGCCCTGCCTCGCGGGGAGG - Intergenic
1002184190 5:177446702-177446724 CCCAGCCACACGCCGCGAGGAGG - Intronic
1005649464 6:27873391-27873413 CCGTGCCAGGCGTCGGATGGCGG + Exonic
1012401875 6:98848075-98848097 CCCAGCCAGGCCTGGCGTCTGGG + Intergenic
1012983626 6:105853934-105853956 CCCAGCCAGCCGCCCCGTCGGGG - Intergenic
1015556010 6:134462357-134462379 CCCAGCCTGGAGTCTAGTGGTGG + Intergenic
1017719781 6:157236308-157236330 CCCACCCAGGCGGAGCGCGGCGG + Intergenic
1018706157 6:166464574-166464596 CCCAGCCTGGCGTCCCTTGCAGG - Intronic
1020414024 7:7925245-7925267 ATCAGCCAGGCGTGGTGTGGTGG - Intronic
1023018571 7:35989112-35989134 CCCAGCCAGGCCTCGTGCAGGGG + Intergenic
1023856875 7:44189422-44189444 TCCAGCCAGGTGTGGAGTGGGGG + Intronic
1029192279 7:98780472-98780494 GCCAGCCTGGCGTCGCGGTGAGG - Intergenic
1032159978 7:129502645-129502667 CCCAGCGAGGCGTGGCGGGGAGG + Exonic
1033220409 7:139523682-139523704 CCCAGCCCGGCTGTGCGTGGAGG + Intergenic
1033863936 7:145664524-145664546 CCCAGCCTGTCGTGGGGTGGGGG + Intergenic
1034291177 7:149932929-149932951 CCAAACCAGGCATCGAGTGGAGG + Intergenic
1034417951 7:150975044-150975066 CCCAGCCATGCTTCCTGTGGCGG - Intronic
1034814921 7:154164003-154164025 CCAAACCAGGCATCGAGTGGAGG - Intronic
1035469409 7:159100099-159100121 CCCAGCCAGGCGACTCCTGCAGG + Intronic
1038492248 8:27979704-27979726 ATTAGCCAGGCGTGGCGTGGCGG - Intronic
1044800115 8:95945300-95945322 CCCAGCCTGGCTTCAGGTGGGGG - Intergenic
1046661181 8:116949884-116949906 CCCAGCCCTGCGCCGCGGGGAGG + Intergenic
1047631684 8:126714767-126714789 CCGAGCCATGCGCCGCGGGGAGG + Intergenic
1048040453 8:130722742-130722764 ATTAGCCAGGCGTCTCGTGGCGG - Intergenic
1049624651 8:143614577-143614599 CCCAGCCAGGAGTCGGGGAGAGG - Intronic
1053129129 9:35605441-35605463 CCCAGCCAGCCGGCGCGGCGGGG + Intronic
1055321534 9:75087960-75087982 CCCAGCAAGGCGGCGCGGCGCGG + Intronic
1056568502 9:87796006-87796028 CACAGCCAGGCTTGGCATGGAGG + Intergenic
1057995506 9:99819597-99819619 GCCAGCCCCGAGTCGCGTGGGGG - Intergenic
1061373231 9:130209611-130209633 CCCAGCCTGGCGCCGTGTTGGGG + Intronic
1062030690 9:134360639-134360661 CTCAGCCTGGCGTTGCATGGGGG + Intronic
1062058588 9:134482384-134482406 CTCAGCCAGGCGAGGAGTGGGGG - Intergenic
1062227642 9:135462387-135462409 CCCAGCCAGGTGGAGAGTGGCGG + Intergenic
1062469596 9:136696751-136696773 CCCAGCCTGGCGGAGCCTGGGGG + Intergenic
1062616523 9:137399101-137399123 CACAGCCAGGCTTCCAGTGGAGG - Intronic
1062620315 9:137417599-137417621 CCCAGCCGCGCTGCGCGTGGCGG + Intronic
1187863649 X:23704465-23704487 TCCAGCCAGGCTGGGCGTGGTGG - Intronic
1188451099 X:30308848-30308870 CACGGCCAGGGGGCGCGTGGTGG - Exonic
1189336056 X:40171614-40171636 CCCGGCCAGGCGTGGAGTAGGGG + Intronic
1194568314 X:95521552-95521574 CCTTGCCAGGGGTTGCGTGGAGG - Intergenic
1194611532 X:96051063-96051085 CCCAGCCAGCCGTCCCGTCCGGG - Intergenic
1199844150 X:151678718-151678740 CCCAGCCAGGCTTTGCATGGTGG - Intergenic
1201017397 Y:9619770-9619792 CCCAGTCAGGCAGGGCGTGGTGG - Intergenic
1201059475 Y:10032705-10032727 CCCAGTCAGGCTGGGCGTGGTGG - Intergenic