ID: 1164664778

View in Genome Browser
Species Human (GRCh38)
Location 19:30021235-30021257
Sequence CACACCCGGCCTCCCCCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164664768_1164664778 26 Left 1164664768 19:30021186-30021208 CCCGAGTAGTGTACGTTGTACCC 0: 11
1: 79
2: 341
3: 1100
4: 2046
Right 1164664778 19:30021235-30021257 CACACCCGGCCTCCCCCTTCTGG No data
1164664770_1164664778 6 Left 1164664770 19:30021206-30021228 CCCAATATGTAGTTTTTTATCCC 0: 30
1: 260
2: 1315
3: 2680
4: 3658
Right 1164664778 19:30021235-30021257 CACACCCGGCCTCCCCCTTCTGG No data
1164664769_1164664778 25 Left 1164664769 19:30021187-30021209 CCGAGTAGTGTACGTTGTACCCA 0: 8
1: 77
2: 305
3: 1078
4: 1678
Right 1164664778 19:30021235-30021257 CACACCCGGCCTCCCCCTTCTGG No data
1164664771_1164664778 5 Left 1164664771 19:30021207-30021229 CCAATATGTAGTTTTTTATCCCT 0: 33
1: 241
2: 1480
3: 2315
4: 3177
Right 1164664778 19:30021235-30021257 CACACCCGGCCTCCCCCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164664778 Original CRISPR CACACCCGGCCTCCCCCTTC TGG Intergenic
No off target data available for this crispr