ID: 1164668386

View in Genome Browser
Species Human (GRCh38)
Location 19:30058519-30058541
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164668378_1164668386 23 Left 1164668378 19:30058473-30058495 CCTTTTCTCTTAGCAGAGTATTG No data
Right 1164668386 19:30058519-30058541 CTGAAGGAATGTTTTGGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164668386 Original CRISPR CTGAAGGAATGTTTTGGGAA TGG Intergenic