ID: 1164668583

View in Genome Browser
Species Human (GRCh38)
Location 19:30059916-30059938
Sequence GCGCATCCACGCGTGGACGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164668583_1164668597 30 Left 1164668583 19:30059916-30059938 CCCACGTCCACGCGTGGATGCGC No data
Right 1164668597 19:30059969-30059991 CCGGGATGCGGCAGATGAGCCGG No data
1164668583_1164668592 18 Left 1164668583 19:30059916-30059938 CCCACGTCCACGCGTGGATGCGC No data
Right 1164668592 19:30059957-30059979 GACCCAGCTCTCCCGGGATGCGG No data
1164668583_1164668590 12 Left 1164668583 19:30059916-30059938 CCCACGTCCACGCGTGGATGCGC No data
Right 1164668590 19:30059951-30059973 CGACCTGACCCAGCTCTCCCGGG No data
1164668583_1164668589 11 Left 1164668583 19:30059916-30059938 CCCACGTCCACGCGTGGATGCGC No data
Right 1164668589 19:30059950-30059972 TCGACCTGACCCAGCTCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164668583 Original CRISPR GCGCATCCACGCGTGGACGT GGG (reversed) Intergenic