ID: 1164668793

View in Genome Browser
Species Human (GRCh38)
Location 19:30061520-30061542
Sequence TGGGCCACCTTGGGAAGACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164668793_1164668799 15 Left 1164668793 19:30061520-30061542 CCTGGTCTTCCCAAGGTGGCCCA No data
Right 1164668799 19:30061558-30061580 CGACTTCTTCCTGGCTTCCCTGG No data
1164668793_1164668798 6 Left 1164668793 19:30061520-30061542 CCTGGTCTTCCCAAGGTGGCCCA No data
Right 1164668798 19:30061549-30061571 ACTGTGTGACGACTTCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164668793 Original CRISPR TGGGCCACCTTGGGAAGACC AGG (reversed) Intergenic
No off target data available for this crispr