ID: 1164680109

View in Genome Browser
Species Human (GRCh38)
Location 19:30128495-30128517
Sequence TCTCCGCAGGTATCTGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164680109_1164680112 2 Left 1164680109 19:30128495-30128517 CCTTCTTCAGATACCTGCGGAGA No data
Right 1164680112 19:30128520-30128542 CTTCCAAGACAGCACCGTGGTGG No data
1164680109_1164680115 16 Left 1164680109 19:30128495-30128517 CCTTCTTCAGATACCTGCGGAGA No data
Right 1164680115 19:30128534-30128556 CCGTGGTGGTGTTTAATGAATGG No data
1164680109_1164680111 -1 Left 1164680109 19:30128495-30128517 CCTTCTTCAGATACCTGCGGAGA No data
Right 1164680111 19:30128517-30128539 ACACTTCCAAGACAGCACCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164680109 Original CRISPR TCTCCGCAGGTATCTGAAGA AGG (reversed) Intergenic