ID: 1164680110

View in Genome Browser
Species Human (GRCh38)
Location 19:30128508-30128530
Sequence TGTCTTGGAAGTGTCTCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164680110_1164680115 3 Left 1164680110 19:30128508-30128530 CCTGCGGAGACACTTCCAAGACA No data
Right 1164680115 19:30128534-30128556 CCGTGGTGGTGTTTAATGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164680110 Original CRISPR TGTCTTGGAAGTGTCTCCGC AGG (reversed) Intergenic
No off target data available for this crispr