ID: 1164680115

View in Genome Browser
Species Human (GRCh38)
Location 19:30128534-30128556
Sequence CCGTGGTGGTGTTTAATGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164680109_1164680115 16 Left 1164680109 19:30128495-30128517 CCTTCTTCAGATACCTGCGGAGA No data
Right 1164680115 19:30128534-30128556 CCGTGGTGGTGTTTAATGAATGG No data
1164680107_1164680115 29 Left 1164680107 19:30128482-30128504 CCTGGTTTCACAGCCTTCTTCAG No data
Right 1164680115 19:30128534-30128556 CCGTGGTGGTGTTTAATGAATGG No data
1164680110_1164680115 3 Left 1164680110 19:30128508-30128530 CCTGCGGAGACACTTCCAAGACA No data
Right 1164680115 19:30128534-30128556 CCGTGGTGGTGTTTAATGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164680115 Original CRISPR CCGTGGTGGTGTTTAATGAA TGG Intergenic