ID: 1164680652

View in Genome Browser
Species Human (GRCh38)
Location 19:30131730-30131752
Sequence GCCCGGGCAGCTGGTGCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164680647_1164680652 -8 Left 1164680647 19:30131715-30131737 CCTAGCCCGGTGCCTGCCCGGGC No data
Right 1164680652 19:30131730-30131752 GCCCGGGCAGCTGGTGCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164680652 Original CRISPR GCCCGGGCAGCTGGTGCTGA TGG Intergenic