ID: 1164682945

View in Genome Browser
Species Human (GRCh38)
Location 19:30148009-30148031
Sequence GATGCAGCTGTCCCTGGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164682937_1164682945 23 Left 1164682937 19:30147963-30147985 CCGGCTGGGGTTCCTGCATTTTT No data
Right 1164682945 19:30148009-30148031 GATGCAGCTGTCCCTGGGTGTGG No data
1164682940_1164682945 11 Left 1164682940 19:30147975-30147997 CCTGCATTTTTGTTCATGGTGGG No data
Right 1164682945 19:30148009-30148031 GATGCAGCTGTCCCTGGGTGTGG No data
1164682936_1164682945 24 Left 1164682936 19:30147962-30147984 CCCGGCTGGGGTTCCTGCATTTT No data
Right 1164682945 19:30148009-30148031 GATGCAGCTGTCCCTGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164682945 Original CRISPR GATGCAGCTGTCCCTGGGTG TGG Intergenic
No off target data available for this crispr