ID: 1164683301

View in Genome Browser
Species Human (GRCh38)
Location 19:30150261-30150283
Sequence CAGTGAGCACCTGATTGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164683292_1164683301 25 Left 1164683292 19:30150213-30150235 CCAAGTCGGATCAGGAGGAGTGG No data
Right 1164683301 19:30150261-30150283 CAGTGAGCACCTGATTGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164683301 Original CRISPR CAGTGAGCACCTGATTGCAG GGG Intergenic
No off target data available for this crispr