ID: 1164683339

View in Genome Browser
Species Human (GRCh38)
Location 19:30150459-30150481
Sequence GACAAACCTGGTATTCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164683339_1164683342 10 Left 1164683339 19:30150459-30150481 CCTCTCTGAATACCAGGTTTGTC No data
Right 1164683342 19:30150492-30150514 TGAGAATAACGTCCACCTTGAGG No data
1164683339_1164683343 13 Left 1164683339 19:30150459-30150481 CCTCTCTGAATACCAGGTTTGTC No data
Right 1164683343 19:30150495-30150517 GAATAACGTCCACCTTGAGGTGG No data
1164683339_1164683344 20 Left 1164683339 19:30150459-30150481 CCTCTCTGAATACCAGGTTTGTC No data
Right 1164683344 19:30150502-30150524 GTCCACCTTGAGGTGGTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164683339 Original CRISPR GACAAACCTGGTATTCAGAG AGG (reversed) Intergenic
No off target data available for this crispr