ID: 1164684011

View in Genome Browser
Species Human (GRCh38)
Location 19:30155130-30155152
Sequence AGGTATATGGAGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164683998_1164684011 21 Left 1164683998 19:30155086-30155108 CCAGCCCTGGGTTCCTCTCCTCA No data
Right 1164684011 19:30155130-30155152 AGGTATATGGAGAAGGAGGAGGG No data
1164684003_1164684011 3 Left 1164684003 19:30155104-30155126 CCTCAGGTGTTGAAAATCCAATA No data
Right 1164684011 19:30155130-30155152 AGGTATATGGAGAAGGAGGAGGG No data
1164684001_1164684011 16 Left 1164684001 19:30155091-30155113 CCTGGGTTCCTCTCCTCAGGTGT No data
Right 1164684011 19:30155130-30155152 AGGTATATGGAGAAGGAGGAGGG No data
1164683996_1164684011 23 Left 1164683996 19:30155084-30155106 CCCCAGCCCTGGGTTCCTCTCCT No data
Right 1164684011 19:30155130-30155152 AGGTATATGGAGAAGGAGGAGGG No data
1164683994_1164684011 29 Left 1164683994 19:30155078-30155100 CCTCCTCCCCAGCCCTGGGTTCC No data
Right 1164684011 19:30155130-30155152 AGGTATATGGAGAAGGAGGAGGG No data
1164684002_1164684011 8 Left 1164684002 19:30155099-30155121 CCTCTCCTCAGGTGTTGAAAATC No data
Right 1164684011 19:30155130-30155152 AGGTATATGGAGAAGGAGGAGGG No data
1164683995_1164684011 26 Left 1164683995 19:30155081-30155103 CCTCCCCAGCCCTGGGTTCCTCT No data
Right 1164684011 19:30155130-30155152 AGGTATATGGAGAAGGAGGAGGG No data
1164684000_1164684011 17 Left 1164684000 19:30155090-30155112 CCCTGGGTTCCTCTCCTCAGGTG No data
Right 1164684011 19:30155130-30155152 AGGTATATGGAGAAGGAGGAGGG No data
1164683997_1164684011 22 Left 1164683997 19:30155085-30155107 CCCAGCCCTGGGTTCCTCTCCTC No data
Right 1164684011 19:30155130-30155152 AGGTATATGGAGAAGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164684011 Original CRISPR AGGTATATGGAGAAGGAGGA GGG Intergenic
No off target data available for this crispr