ID: 1164691855

View in Genome Browser
Species Human (GRCh38)
Location 19:30217246-30217268
Sequence CTGGTGATGAACCATGTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164691842_1164691855 21 Left 1164691842 19:30217202-30217224 CCTAATGATCTGCATGGTGCCAG No data
Right 1164691855 19:30217246-30217268 CTGGTGATGAACCATGTTTGGGG No data
1164691848_1164691855 2 Left 1164691848 19:30217221-30217243 CCAGGGATTGGGCTAGGCCTAGG No data
Right 1164691855 19:30217246-30217268 CTGGTGATGAACCATGTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164691855 Original CRISPR CTGGTGATGAACCATGTTTG GGG Intergenic
No off target data available for this crispr