ID: 1164692393

View in Genome Browser
Species Human (GRCh38)
Location 19:30221295-30221317
Sequence GCACCCTGAGTTGCTAAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164692393_1164692397 -3 Left 1164692393 19:30221295-30221317 CCTGTCTTAGCAACTCAGGGTGC No data
Right 1164692397 19:30221315-30221337 TGCAGGGCAGGAACCAGCCCTGG No data
1164692393_1164692402 20 Left 1164692393 19:30221295-30221317 CCTGTCTTAGCAACTCAGGGTGC No data
Right 1164692402 19:30221338-30221360 ACAGGATGCCATCTCATTGCAGG No data
1164692393_1164692398 2 Left 1164692393 19:30221295-30221317 CCTGTCTTAGCAACTCAGGGTGC No data
Right 1164692398 19:30221320-30221342 GGCAGGAACCAGCCCTGGACAGG 0: 13
1: 42
2: 75
3: 162
4: 497
1164692393_1164692403 21 Left 1164692393 19:30221295-30221317 CCTGTCTTAGCAACTCAGGGTGC No data
Right 1164692403 19:30221339-30221361 CAGGATGCCATCTCATTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164692393 Original CRISPR GCACCCTGAGTTGCTAAGAC AGG (reversed) Intergenic
No off target data available for this crispr