ID: 1164692397

View in Genome Browser
Species Human (GRCh38)
Location 19:30221315-30221337
Sequence TGCAGGGCAGGAACCAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164692393_1164692397 -3 Left 1164692393 19:30221295-30221317 CCTGTCTTAGCAACTCAGGGTGC No data
Right 1164692397 19:30221315-30221337 TGCAGGGCAGGAACCAGCCCTGG No data
1164692390_1164692397 16 Left 1164692390 19:30221276-30221298 CCATCTCAAGGGGCTGGAGCCTG No data
Right 1164692397 19:30221315-30221337 TGCAGGGCAGGAACCAGCCCTGG No data
1164692388_1164692397 24 Left 1164692388 19:30221268-30221290 CCAGTTCACCATCTCAAGGGGCT No data
Right 1164692397 19:30221315-30221337 TGCAGGGCAGGAACCAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164692397 Original CRISPR TGCAGGGCAGGAACCAGCCC TGG Intergenic
No off target data available for this crispr