ID: 1164692398

View in Genome Browser
Species Human (GRCh38)
Location 19:30221320-30221342
Sequence GGCAGGAACCAGCCCTGGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 789
Summary {0: 13, 1: 42, 2: 75, 3: 162, 4: 497}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164692393_1164692398 2 Left 1164692393 19:30221295-30221317 CCTGTCTTAGCAACTCAGGGTGC No data
Right 1164692398 19:30221320-30221342 GGCAGGAACCAGCCCTGGACAGG 0: 13
1: 42
2: 75
3: 162
4: 497
1164692390_1164692398 21 Left 1164692390 19:30221276-30221298 CCATCTCAAGGGGCTGGAGCCTG No data
Right 1164692398 19:30221320-30221342 GGCAGGAACCAGCCCTGGACAGG 0: 13
1: 42
2: 75
3: 162
4: 497
1164692388_1164692398 29 Left 1164692388 19:30221268-30221290 CCAGTTCACCATCTCAAGGGGCT No data
Right 1164692398 19:30221320-30221342 GGCAGGAACCAGCCCTGGACAGG 0: 13
1: 42
2: 75
3: 162
4: 497

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164692398 Original CRISPR GGCAGGAACCAGCCCTGGAC AGG Intergenic
900014531 1:138920-138942 GGCAGGAGCTGGGCCTGGACAGG + Intergenic
900044396 1:494122-494144 GGCAGGAGCTGGGCCTGGACAGG + Intergenic
900065803 1:729028-729050 GGCAGGAGCTGGGCCTGGACAGG + Intergenic
900106271 1:982437-982459 GGGAGGCACAAGCCCTGGCCGGG - Intergenic
900151051 1:1179552-1179574 GGCTGGCACCACCCCTGGAAGGG + Intronic
900154348 1:1198065-1198087 GACAGGGCCCAGCCATGGACTGG - Intergenic
900252977 1:1681067-1681089 GGCAGGAGCCACCCCTGCAGAGG + Intronic
900482016 1:2904086-2904108 GCCAGCATCCAGCCCGGGACTGG + Intergenic
900549383 1:3246521-3246543 GGCAGGGAGGAGCCCTGGGCTGG - Intronic
900611024 1:3544726-3544748 GCCCGGCACCAGCCCTGGCCTGG + Intronic
900767854 1:4517508-4517530 TGCAGGAGCCAGTCCTGGACAGG + Intergenic
901560996 1:10070492-10070514 GGCAGGAAGCAGCTCGGGAGAGG - Intronic
901667492 1:10835037-10835059 GGCAGCTGCCAGCCCTGGAAAGG - Intergenic
901787476 1:11634318-11634340 GGCAGGCACCAAACCTGGAGAGG + Intergenic
901948672 1:12724204-12724226 GGCAGGAACCAACCCTGGACAGG + Intronic
902192553 1:14773797-14773819 GGCAGGTCCCAGCCCAGGCCAGG + Intronic
902662804 1:17917094-17917116 GGCAGCAACCAGCCCAAGAAAGG - Intergenic
902989756 1:20178524-20178546 GGCTGGGACCAGGCCTGGTCAGG - Intergenic
903171684 1:21558437-21558459 GGCTGGAACCAGCCTGGGCCTGG + Intronic
903420774 1:23216971-23216993 GGCAGGAAGCACCCCCGGGCCGG - Intergenic
904388311 1:30162014-30162036 GGAAGGAAGCAGGCCTGGGCAGG - Intergenic
904892515 1:33789806-33789828 GTCAGGAGCCAGCACTGGCCTGG - Intronic
904980749 1:34499085-34499107 TCCAGGAACCTGCCCTGGGCTGG - Intergenic
905058925 1:35122544-35122566 AGCGGGAACCAATCCTGGACAGG + Intergenic
905081574 1:35326641-35326663 GGCAGGAACCAGTCCTGGACAGG + Intronic
905798761 1:40830251-40830273 GGCAGGCACCAGGCATGGCCTGG + Intronic
906555213 1:46705631-46705653 AGCAGGAAACAGCCCTGGACAGG - Intronic
907107687 1:51899113-51899135 AGCGGGAACCAGTCCTGGACAGG + Intergenic
908171002 1:61504629-61504651 GGCAGGCACCAGCTCTGGCTGGG - Intergenic
908288032 1:62630464-62630486 GGCAGGCACCTGTCCTGGACAGG + Intronic
908632477 1:66124963-66124985 GGTGAGAACCAGCCCTGGACAGG - Intronic
909391192 1:75124649-75124671 GGCAGGCAGTAGCCCTGGAGGGG - Intergenic
909492252 1:76238646-76238668 GGAAGGAACCAGCTTTGGAGAGG + Intronic
909500965 1:76335388-76335410 GGTAGTAACCAGCCTGGGACAGG + Intronic
909771951 1:79434884-79434906 GGCAGGAGCGCGCCCTCGACAGG + Intergenic
910267403 1:85352306-85352328 GGCGGCAACCCACCCTGGACAGG - Intronic
910903699 1:92150646-92150668 GGTTGGAACCAACCCTGGACAGG + Intergenic
911519415 1:98910679-98910701 GGCAGTAACCAGCCCCGGACAGG + Intronic
911870000 1:103085329-103085351 GGCGGGAACCAGTCCTGGACAGG + Intronic
912269910 1:108198831-108198853 GGCTGGAAGCAGCCCAGGAAAGG - Intronic
912781397 1:112552059-112552081 GGCAGGAACCCACCCTGGACAGG + Intronic
913216470 1:116624861-116624883 GGCTGGAGCCAGCTCTGGACTGG - Intronic
913708250 1:121450261-121450283 GGCAGGATCCAACCCTGGACAGG + Intergenic
915004330 1:152622760-152622782 GACTGGAACCAGCCCTAGCCTGG - Intergenic
915224033 1:154398819-154398841 GGCAAGAAACAGCCCCAGACAGG + Intergenic
916478025 1:165187964-165187986 GGCAGGCACCATCCTTGGGCTGG + Intergenic
916520545 1:165559930-165559952 GGTGGGAAGCAGCCCTGGCCAGG + Intronic
918494226 1:185115338-185115360 GGCAGGAACCAGCCCTAGACAGG - Intergenic
918609759 1:186475159-186475181 GGCGGGAACCATCCCTGGACAGG - Intergenic
918894355 1:190320614-190320636 GATAAGAACCAGCCCTGGACAGG + Intronic
919267504 1:195289708-195289730 AGCAGGAACCGGTCCTGAACAGG + Intergenic
919978459 1:202627982-202628004 GGAAGGAAAGAGCCCTGGGCTGG - Intronic
920138374 1:203789085-203789107 AGCAGAAACCAAACCTGGACAGG + Intergenic
920498774 1:206473314-206473336 GGTAGGAAGCAACCCTGGCCAGG + Exonic
920926378 1:210345195-210345217 AGCAGGAACCAGCCCTGGACAGG - Intronic
921003357 1:211067517-211067539 GGTAGGAAGCAGCACTGGGCAGG - Intronic
921102710 1:211944338-211944360 GGCAGGAACCAGACATGGGAAGG + Intronic
921123497 1:212156998-212157020 GGCAGGAACCCATCCTGGCCAGG - Intergenic
921464841 1:215475191-215475213 GACAGGAACCAGCCTTGGACAGG - Intergenic
921513700 1:216064287-216064309 GGTAGGAATCAGCCCTGGACAGG + Intronic
921592271 1:217018492-217018514 GGCAGGAACCAGCTCAGAAAAGG - Intronic
921804964 1:219443878-219443900 GGCTGGAACCAGCCCCAGACAGG + Intergenic
922223414 1:223626079-223626101 GGCAGGCACCTGCACTGGCCCGG - Intronic
922238032 1:223736205-223736227 GGCAGCACACAGCCCTGGGCAGG + Intronic
922569454 1:226625424-226625446 TTCAGGAACCAGACCTGGGCAGG - Intergenic
922592561 1:226788612-226788634 GGTGGGAATCAACCCTGGACAGG - Intergenic
922734151 1:227970646-227970668 GGCAGGAGCTGGCCCTGGACAGG - Intergenic
922774086 1:228207088-228207110 GGGAGGGACCAGCCCTGGGGAGG - Intronic
922889205 1:229047372-229047394 GGCAGGCACCAGCATTGGTCAGG + Intergenic
923100362 1:230809452-230809474 TTCAGGATGCAGCCCTGGACTGG + Intergenic
923322986 1:232854948-232854970 GGCAGGATACAGCACAGGACAGG + Intergenic
923498533 1:234545347-234545369 GACAGGCACCAGTCCCGGACAGG - Intergenic
923802902 1:237227726-237227748 GGCAAGAACCCGCCCTGGGCAGG - Intronic
924183037 1:241458400-241458422 GGCCAGAACCAGCTCAGGACAGG + Intergenic
924317257 1:242811180-242811202 GGCAGAAACCAACCCTGGATGGG + Intergenic
924489289 1:244519638-244519660 GGCAGGAGCCTACCCTGGACAGG - Intronic
1062889931 10:1050656-1050678 AGAGGGAACCAGCCCTGGACAGG + Intronic
1062925501 10:1313115-1313137 GCCAGGAACCAGCCGTGGAGTGG + Intronic
1063340576 10:5259495-5259517 GGTAGGAAGCACACCTGGACAGG - Intergenic
1063435054 10:6022612-6022634 GGCAGGAGCCAGCCTGGGACAGG - Intronic
1064209869 10:13352723-13352745 GGCAGGGACCAGCCTGGGACCGG - Intergenic
1064317445 10:14271368-14271390 GGCAGGGCCCAGCCCTAGATAGG + Intronic
1064340780 10:14483539-14483561 GGGAGGAGCCAGCCCTGCAGTGG + Intergenic
1065013007 10:21436443-21436465 GGCTGGAACGATCTCTGGACAGG + Intergenic
1065140817 10:22716375-22716397 GGTGGGAACCATCCCTGGATAGG + Intergenic
1065565401 10:27002543-27002565 GGTGGGAACCAGCCCTGGACAGG - Intronic
1066183209 10:32983407-32983429 GGCAGTCACCAGCCCTGCCCTGG + Intronic
1066196697 10:33106975-33106997 AGCAGGAACGAACCCTGTACTGG - Intergenic
1067047255 10:42991628-42991650 AGCAGATACCAGCCCTGGTCTGG - Intergenic
1067442476 10:46316985-46317007 GGTGGGAACTAACCCTGGACAGG - Intronic
1067939668 10:50643627-50643649 AGGAGGAACTATCCCTGGACAGG - Intergenic
1068257554 10:54532970-54532992 GGCAGGAACCCACCTTGGACAGG - Intronic
1069254583 10:66316491-66316513 GAAGGGAACCAGCCCTGAACAGG + Intronic
1069297242 10:66861473-66861495 GGCAGGAAGCAGCCCAGGACAGG - Intronic
1069327519 10:67249736-67249758 GGCAGGAACCAACCCTGGACAGG + Intronic
1069334772 10:67335265-67335287 GGCAGGAACCAGCCCTTGACAGG - Intronic
1069989855 10:72308543-72308565 GGGAGGAACAGGCCCTTGACAGG + Intergenic
1070031129 10:72678483-72678505 GGTGGGAAGCAGCCCTGGATAGG + Intergenic
1070132260 10:73664026-73664048 GGCAGGGAGCAGGGCTGGACAGG + Intergenic
1070816228 10:79325244-79325266 GACAGGAGCCTGCCCTAGACAGG + Intergenic
1071602844 10:86967333-86967355 TGCAAGAAACAGCCCCGGACAGG + Intronic
1071609420 10:87020049-87020071 GGCAGGGAGCAGGGCTGGACAGG - Intergenic
1072827836 10:98626476-98626498 GGTGAGAACCAGCCATGGACAGG + Intronic
1073744361 10:106448591-106448613 GGCGGGAACCAGCCTCGGACAGG + Intergenic
1074660921 10:115656532-115656554 CGCAGGTACCCACCCTGGACAGG - Intronic
1075092656 10:119452317-119452339 GGCAGGAATGAGCCCTGGGCTGG + Intronic
1075465388 10:122646947-122646969 TGCAGGCACCAGCCCAGGACTGG + Intergenic
1076836324 10:133022881-133022903 GGCAGGAAACAGCCCTCCTCCGG - Intergenic
1076970727 11:130597-130619 GGCAGGAGCTGGGCCTGGACAGG + Intergenic
1077680054 11:4231479-4231501 GGAAGGAACCAACGCTGGACAGG + Intergenic
1077681429 11:4244426-4244448 GGAAGGAATCAACGCTGGACAGG - Intergenic
1077684293 11:4276641-4276663 GGCAGGAATCAACGCTAGACAGG + Intergenic
1077685746 11:4290127-4290149 GGCAGGAACCAACGCTGGACAGG - Intergenic
1077689465 11:4328056-4328078 GGAAGGAACCAACGCTGGACAGG + Intergenic
1077690896 11:4341287-4341309 GGCAGGAACCAACGCTGGACAGG - Intergenic
1078583761 11:12561891-12561913 GACAGGAGCCAGCCCTGGAGGGG + Intergenic
1078609468 11:12807814-12807836 GGCAGTGGCCAGACCTGGACAGG + Intronic
1078626722 11:12964785-12964807 GGTGGGACCCAGCCCTGGATAGG + Intergenic
1079035849 11:17019422-17019444 GGCTGGAAAGGGCCCTGGACAGG - Intergenic
1079171806 11:18103648-18103670 GGCAGAAACCAGCCCTGGACAGG - Intronic
1079250073 11:18780690-18780712 GCCAGGGAGCAGCCCGGGACAGG - Intronic
1080678437 11:34449925-34449947 GGCAAGAGCCAGCCCTGGACAGG + Intronic
1081696057 11:45109875-45109897 GGGAGGAAACATCCCTGAACAGG - Intronic
1081719311 11:45275687-45275709 GGCAGCAACTGGCCCTGGAGAGG + Intronic
1081847510 11:46251530-46251552 AGCAGGAGGCAGCCCTGGAGAGG + Intergenic
1082260254 11:50072611-50072633 GGCAGGAGCTGGCCCTGGAGAGG + Intergenic
1082260916 11:50075838-50075860 GGCAGGAACTGGACCTGGATAGG + Intergenic
1082260997 11:50076259-50076281 GGCAGGAACTGGGCCTGGAGAGG + Intergenic
1082261265 11:50077635-50077657 GGCAGGAGCTAGGCCTGGAAAGG + Intergenic
1082953395 11:58842542-58842564 GGCAGGAACCCACCCCAGACTGG - Intronic
1082969804 11:59007829-59007851 GGCAGGAACCCACCCTGGACTGG - Intronic
1083688600 11:64392640-64392662 ATCAGGAACCAGCCCGGGAATGG - Intergenic
1084171857 11:67404770-67404792 GGCTGGAGAGAGCCCTGGACTGG - Intronic
1084274162 11:68043281-68043303 GGCAGGACCCTGCCCAGCACGGG - Intronic
1084938057 11:72597662-72597684 GGGAGGAACGAGGCCTGGCCTGG + Intronic
1085033924 11:73288982-73289004 GGCAGGAACCAGCTCAGACCAGG - Intronic
1085279353 11:75320054-75320076 AGCAGGAGGCAGCCCTGGAGTGG + Intronic
1085561732 11:77478013-77478035 GGCAGGAACCAACCATGTATAGG + Intergenic
1085912149 11:80840284-80840306 GGCAGGAACCAGCCCTGGACAGG - Intergenic
1085931735 11:81091644-81091666 GGCAGGAACTGACCCTGGACAGG - Intergenic
1087432549 11:98071777-98071799 GGCAGAAACCAGCCCTGGACAGG - Intergenic
1087753322 11:102029066-102029088 GGCAGGAACAAACTCTGTACCGG - Intergenic
1088289126 11:108217217-108217239 GGCAGGAACTAACCCTGGGCAGG - Intronic
1088929278 11:114333491-114333513 GGCAGGAACCAGTGCTTGAGTGG + Intergenic
1090268864 11:125371621-125371643 GGCAGGAGCTAGGCCTGGCCAGG + Intronic
1090367239 11:126216953-126216975 GGCAGGCGCCAGCCCTGGACAGG + Intronic
1090390120 11:126382789-126382811 GGCAGTCACCAGGCCTTGACAGG + Intronic
1090450594 11:126802624-126802646 GGCGGGAGCCAGCCCCCGACAGG - Intronic
1090714592 11:129419123-129419145 GGCGGGGGCCGGCCCTGGACAGG - Intronic
1091612387 12:2022218-2022240 AGCAGGATCCAATCCTGGACAGG - Intronic
1092281997 12:7104627-7104649 GGCATGAACCAGTGCTGGACAGG - Intronic
1092909227 12:13131632-13131654 GGCAGGCAACCACCCTGGACAGG - Intronic
1095401216 12:41816531-41816553 GGCAGGAACCATCCCTGGACAGG + Intergenic
1095658290 12:44697300-44697322 GGCAGGAACCAGCCCTGACCAGG + Intronic
1096148421 12:49294587-49294609 GCCAGGCACCAGCCCTTCACAGG + Exonic
1096311205 12:50522417-50522439 GACGGGAACCAGCCCTGGAAAGG + Intronic
1096501531 12:52066879-52066901 GGTTGGAACCAGTCCTGGAGTGG - Intergenic
1097566214 12:61271991-61272013 GGCAGGAACCAGAACTGGATGGG + Intergenic
1097639361 12:62160855-62160877 GGGGGGCACCAGCACTGGACTGG - Intronic
1098239866 12:68456129-68456151 TACAGGAACCTGACCTGGACAGG - Intergenic
1098863597 12:75736917-75736939 GTTGGGAACCAACCCTGGACAGG + Intergenic
1099014538 12:77328463-77328485 GGCGGGAACCAGCCCTAGACAGG + Intergenic
1099317143 12:81098208-81098230 GGCAGGAACCAGCCCCAGACAGG - Intronic
1099494913 12:83335282-83335304 GGCAGGAACAAGCTCTGTGCAGG + Intergenic
1099545096 12:83969374-83969396 GGTGGGAACCAGCCCTGGACAGG + Intergenic
1099594920 12:84649036-84649058 GGAAAAAACCAGCCCTGTACTGG + Intergenic
1100452038 12:94716471-94716493 GGCAAGAACACACCCTGGACAGG + Intergenic
1101114954 12:101522988-101523010 GGCAGGTACCATCCCTGAACAGG + Intergenic
1101258975 12:103009704-103009726 GGCAGGAACCCACCCTGGATAGG - Intergenic
1101335320 12:103791510-103791532 GGAAGAAACCAGCCCTGGCCTGG + Intronic
1101388430 12:104278293-104278315 GGCAGGAAAAAGGCGTGGACCGG - Intronic
1101467026 12:104958769-104958791 GGCAGGAACCACCGCAGGAGGGG + Intergenic
1101614261 12:106320624-106320646 GGCAGGAACCAGCCCTGGACAGG - Intronic
1101821068 12:108184578-108184600 GGCAGGAACCAGCTCAGCCCTGG + Intronic
1102826631 12:115952465-115952487 GGCAGGCATCATCCCTGGCCTGG - Intergenic
1102923818 12:116811893-116811915 AATAGGCACCAGCCCTGGACTGG + Intronic
1103424555 12:120821389-120821411 AGCCGGAAACAGCCCTGGGCTGG + Intronic
1103446301 12:120997330-120997352 GTCAGGAAACAGCCCTCCACTGG - Intronic
1103761081 12:123250864-123250886 GGGAGGAACCAGCAGTGGGCGGG + Intronic
1104548519 12:129733756-129733778 GACAGGACGCTGCCCTGGACCGG + Intronic
1104761235 12:131298690-131298712 GGCAGGAAGCAGCGCGGGAGGGG + Intergenic
1104818540 12:131662102-131662124 GGCAGGAAGCAGCGCGGGAGGGG - Intergenic
1106121518 13:26863486-26863508 GGCAGGGACCATGCCTGGACTGG + Intergenic
1106774573 13:32996452-32996474 GACAGGACCCAGCCCTGGACAGG + Intergenic
1107304916 13:39007646-39007668 GGCAGGGACCCATCCTGGACAGG - Intergenic
1108224693 13:48276084-48276106 GGCGGGAGCCAGTGCTGGACAGG - Intergenic
1108347221 13:49558264-49558286 GGTGGGAAGCAGCCCTGGACAGG - Intronic
1108402456 13:50060598-50060620 GGTGGGAACCAACCCTGGATAGG - Intergenic
1108480599 13:50866304-50866326 GGCAGGAACCAGCCCTGGACAGG - Intergenic
1109886138 13:68547650-68547672 TAGTGGAACCAGCCCTGGACAGG - Intergenic
1110181284 13:72620448-72620470 GGTGGGCACCAGCCCTGGACAGG - Intergenic
1110461522 13:75750674-75750696 GGCATGAACCACCACTGGCCGGG + Intronic
1110603833 13:77408336-77408358 GGCACGAACCTGTGCTGGACAGG + Intergenic
1110854234 13:80278968-80278990 GGCAGGAACCAGGGCTGCGCGGG - Intergenic
1112097247 13:96147687-96147709 GGTGGGAACCAGCCCTGGACAGG - Intronic
1112368161 13:98773240-98773262 GGAAGGAACCAGACCTGTAGAGG + Intergenic
1113585327 13:111460576-111460598 GGCTGAAACCATCCCTGCACCGG - Intergenic
1113614112 13:111669073-111669095 GGCGGCAACCAGCCCCGGAATGG - Intronic
1113619579 13:111753987-111754009 GGCGGCAACCAGCCCCGGAATGG - Intergenic
1113849255 13:113408799-113408821 GGCAGGAACCAGCACTGCAGTGG + Intergenic
1115002740 14:28441656-28441678 GGCAGGAACCACCTCAGAACTGG + Intergenic
1115105041 14:29750561-29750583 GGCAGGAACCAGCCTTGGACAGG + Intronic
1115275161 14:31600332-31600354 GGCAGGAATCAACCCTGGAAAGG + Intronic
1115657058 14:35453429-35453451 AGCAGAAACCCACCCTGGACGGG - Intergenic
1116053255 14:39831364-39831386 GGCGGGAGCTAACCCTGGACAGG + Intergenic
1116356704 14:43939050-43939072 GGCACCAACCAGCACTGGAGAGG + Intergenic
1116600207 14:46911921-46911943 GACAGGAACCAACACTGAACAGG + Intronic
1116743572 14:48788930-48788952 TGCAGCAACCAACCCTGGACAGG + Intergenic
1117347944 14:54852412-54852434 GGCAGGAACTGACCCTGGACAGG + Intronic
1117368920 14:55058064-55058086 GTTGGGAACCAGCCCTGAACTGG + Intronic
1117387673 14:55232322-55232344 GGCAGAAACCCACCCTGGCCAGG + Intergenic
1117555312 14:56877678-56877700 GGCAGGAACCAGCCCTGAACAGG - Intergenic
1117880278 14:60306455-60306477 GGTAGGAACTGACCCTGGACAGG + Intergenic
1117942230 14:60980892-60980914 GGCAGAGAGCAGCCCTGGGCGGG + Intronic
1118031887 14:61826160-61826182 GGTTGGAACCAGCCCTGGACAGG + Intergenic
1118082915 14:62382295-62382317 GGTGGGAACCAGCCCCGGACAGG - Intergenic
1118245182 14:64103565-64103587 GGGAGGGGTCAGCCCTGGACAGG - Intronic
1119427788 14:74547023-74547045 GGCAGCAGCCAGCCCTGGCATGG + Intronic
1119767300 14:77198344-77198366 TGGAGGAACAAGCCCTGGGCTGG + Intronic
1122099247 14:99394231-99394253 GGGAAGAACCAGCCATGAACAGG - Intergenic
1122922302 14:104885100-104885122 GGCAGGAGCCAGGGCTGGGCCGG - Intronic
1123806299 15:23877519-23877541 GACAGGCATCAGACCTGGACTGG + Intergenic
1123827849 15:24101429-24101451 GGCAGAAACCTGCCCTGGCGGGG - Intergenic
1123857339 15:24426902-24426924 GGCAGAAACCTGCCCTGGCGGGG - Intergenic
1123861965 15:24477430-24477452 GGCAGAAACCTGCCCTGGCGGGG - Intergenic
1124118102 15:26866766-26866788 GGAAGGACCCAGGCCTGGGCAGG + Exonic
1124140495 15:27073025-27073047 GGCTGGATGCAGCACTGGACAGG - Intronic
1125130191 15:36275538-36275560 GGTGGGCACCAACCCTGGACAGG + Intergenic
1125493087 15:40163160-40163182 GAGAGGAACCAACCCTGGACAGG - Intronic
1125510510 15:40290186-40290208 GGCAGGAACCAGCTGGGGGCAGG + Intronic
1125721738 15:41848417-41848439 GGCAGGAAACAGCCATTGCCTGG - Exonic
1125804924 15:42485618-42485640 GGTAGAAACCAACCCTGGACAGG - Intronic
1125932602 15:43611210-43611232 GGCAGGAACAAGCCCCGACCAGG + Exonic
1125945700 15:43710672-43710694 GGCAGGAACAAGCCCCGACCAGG + Intergenic
1126186536 15:45836101-45836123 GGCAGGAACCTACCCTGGACAGG - Intergenic
1126253629 15:46598384-46598406 AGCAGAAACCAACCCTGGACAGG - Intergenic
1126341740 15:47648390-47648412 GATGGGAACCAGCCCTGGAGAGG - Intronic
1126364582 15:47881325-47881347 GTCAGAAACCAGCCTGGGACAGG + Intergenic
1127126138 15:55813667-55813689 GGTGGGAACCAATCCTGGACAGG + Intergenic
1127470750 15:59287802-59287824 GGCAGGAACCAGGCCTGGACAGG - Intronic
1128444956 15:67751076-67751098 GGCAAGAGCCAGTCCTGGAATGG + Intronic
1129382678 15:75177999-75178021 GGCTGGAAAGAGCCCAGGACTGG + Intergenic
1129771055 15:78203890-78203912 GGCAGGAACCAGCCCCAGGAGGG + Intronic
1129800996 15:78414165-78414187 GGTAGGAACCCACCCTGGACAGG + Intergenic
1130045702 15:80443044-80443066 ACCAGGGACCAGACCTGGACTGG + Intronic
1130552044 15:84895455-84895477 CGCAGGGACCATCCCTGGAGGGG + Intronic
1130966508 15:88701280-88701302 GGAAGGAGCCAGCCAGGGACAGG - Intergenic
1131340767 15:91598681-91598703 GACAAGAACCAGCCATAGACAGG + Intergenic
1131807326 15:96136228-96136250 GGTTGGAACCAGCCCTGGGCAGG - Intergenic
1132067516 15:98744422-98744444 GGCTGGAAGCAGCTCTGGAGAGG + Intronic
1132722879 16:1325669-1325691 GGCAGCCCCCAGCCCTGGTCTGG - Exonic
1132779232 16:1614010-1614032 GGCCGGATCCACCCCGGGACGGG - Intronic
1133721597 16:8499355-8499377 GGCAGAAAGCAGTCCTGGACAGG - Intergenic
1135300866 16:21325921-21325943 GGCAAGAACCAACCCTAGACTGG - Intergenic
1135735893 16:24931447-24931469 GGCAGCAACCAACCCTGGCCAGG + Intronic
1137227175 16:46524436-46524458 GAAAGGACCCAGTCCTGGACTGG - Intergenic
1137235250 16:46611183-46611205 GGCAGGAACCAGCTGTGGACAGG - Intronic
1137490755 16:48930567-48930589 GGCAGGAACTTGCCCTGGCTAGG + Intergenic
1138168804 16:54829829-54829851 GGCAGGAACCAGGGCTGCGCTGG + Intergenic
1138185957 16:54977852-54977874 GGTAGGAACCCACCCTGGATAGG + Intergenic
1138218903 16:55233034-55233056 AGTGGGAACCAGCCCCGGACAGG - Intergenic
1138439561 16:57025980-57026002 GGCAGGCAGCTTCCCTGGACGGG - Exonic
1138520194 16:57566638-57566660 GCCAGGAAACAGCCCTGGGGGGG + Exonic
1139428531 16:66898386-66898408 GGCGGGAACCAGGCCTAGACAGG + Intergenic
1139846518 16:69925110-69925132 GGCAGGGAGCAGCCCTGGCATGG - Intronic
1141291300 16:82720459-82720481 GGTAGGAACTGACCCTGGACAGG + Intronic
1142159935 16:88552150-88552172 GACAGGTGCCAGCTCTGGACTGG + Intergenic
1142160504 16:88555013-88555035 GGCTTGGACCAGCCCTGGAAGGG - Intergenic
1142221597 16:88857505-88857527 GCGGGGAACCAGCGCTGGACGGG - Intronic
1142225093 16:88873359-88873381 GGCAGGGGCCACACCTGGACTGG - Intergenic
1142449522 16:90166886-90166908 GGCAGGAGCTGGGCCTGGACAGG - Intergenic
1142496630 17:309629-309651 GGCTGGCAGGAGCCCTGGACGGG - Intronic
1142721240 17:1777307-1777329 GGCAGGCTGCAGCCCTGGGCTGG - Exonic
1143199305 17:5100946-5100968 CTCTGGACCCAGCCCTGGACTGG - Intergenic
1143335658 17:6169787-6169809 GGCAAGAACCAGCGCTGGTCAGG + Intergenic
1143498636 17:7326419-7326441 GTCAGGTACCAGCCCCGGGCAGG - Exonic
1143513763 17:7409106-7409128 GCCAGGAACAAGCCCAGGTCTGG - Intronic
1143839145 17:9717700-9717722 GGCAGGAACCAGCCCTGGATAGG - Intronic
1144654723 17:17028341-17028363 GGGTGGACCCAGCCCTGGACAGG - Intergenic
1144758766 17:17695270-17695292 TGCAGGGTCCAGGCCTGGACCGG - Intronic
1145290722 17:21543605-21543627 GCCAGCAACCAGCCCTTGAGAGG - Intronic
1145956140 17:28856194-28856216 GGCAGGAACAAGCACTTGACAGG + Intronic
1146064550 17:29623916-29623938 GGCAGGAACCAGCACTGGGGAGG + Intergenic
1146485007 17:33235658-33235680 AGAAGGAACCTGCCCTGGACAGG + Intronic
1147015990 17:37491401-37491423 GGTAGGAAGGAGCCCTGCACAGG + Intronic
1147213404 17:38885429-38885451 GGCAGGAACAGGGACTGGACAGG - Intronic
1147267791 17:39245199-39245221 GGCAGGAGCCAGACCTGTAGGGG + Intergenic
1147419736 17:40316630-40316652 GGTGAGAACCAGCCCAGGACTGG - Intronic
1148645070 17:49215308-49215330 GGCAGGAGCCAGACCTGGAGGGG + Intronic
1148647022 17:49225066-49225088 GGCAGGAGCCCGCCCGGGAGAGG + Exonic
1148650227 17:49245032-49245054 GTCAGGCTCCAGCCCTGGTCAGG + Intergenic
1148740457 17:49889874-49889896 CACTGGAACCAGCCCTGGGCAGG - Intergenic
1148740734 17:49890934-49890956 GGCGGGACCCAGCCCGGGAGGGG - Intergenic
1148786113 17:50147084-50147106 GGCAGGGTGCAGCCCAGGACAGG - Intronic
1149105901 17:52964504-52964526 GGTAGGAACCAACCCTGGACAGG - Intergenic
1149292224 17:55228382-55228404 GGAAGGGACAAGCCCAGGACTGG - Intergenic
1150114798 17:62537600-62537622 AGCAGAAACCAGACCTGGACAGG - Intronic
1150704752 17:67476805-67476827 CCCAGGACCCAGCCCTGGCCCGG - Intronic
1152332701 17:79682308-79682330 GGCAGTAGGCAGCACTGGACTGG + Intergenic
1152534249 17:80941256-80941278 GGCAGGGAGCAGCCCTGGAGGGG + Intronic
1152536061 17:80950980-80951002 GGCAGGTCCGAGCCTTGGACAGG - Intronic
1152633052 17:81419357-81419379 GGGAGGAAGCCGCCCTGCACAGG - Intronic
1152645593 17:81467203-81467225 GGCAGAATCCAGCCCGGAACAGG + Intergenic
1152940291 17:83167659-83167681 GGTGGGAACCAATCCTGGACAGG - Intergenic
1152978742 18:251768-251790 GGCGGGAACCAACCCTGTACAGG - Intronic
1153389914 18:4544732-4544754 GGCAGGAGCCAGCCCTGGACGGG - Intergenic
1155466669 18:26143369-26143391 GGCAGGAACCAACCATGGACAGG - Intronic
1155520157 18:26659395-26659417 GTCAGGAGCCAGCCATTGACAGG + Intergenic
1156166157 18:34423788-34423810 TGCAGGATCCAGCCCTGGACAGG - Intergenic
1156397948 18:36716239-36716261 GGCAGGAACCCACGCTGGCCTGG + Intronic
1156972151 18:43169926-43169948 GGCAGGAATTAGCCATGGTCAGG - Intergenic
1157610006 18:48950241-48950263 GGCAGCATCCAGCCCTGCCCGGG + Exonic
1157707639 18:49820904-49820926 GGGAGGCACCAGGCCTGGACAGG - Intronic
1157816607 18:50734145-50734167 GGCAGGAACCAGGCCATCACAGG + Intergenic
1158937261 18:62376092-62376114 GGCAGTAGCCAGGCCTGGCCTGG + Intronic
1158969768 18:62655725-62655747 GGCAGGAACCAGCTCTGGACTGG - Intergenic
1158991635 18:62874600-62874622 GACAGGAACCAGCCCTGGGTAGG + Intronic
1159302199 18:66588237-66588259 GGTGGGAACCAACCCTAGACAGG - Intronic
1159359662 18:67383419-67383441 GGCAGGAACCAACGCTGGACAGG + Intergenic
1159558656 18:69971132-69971154 GGCAGGAACCAGCCCTGGACAGG - Intergenic
1159667904 18:71185864-71185886 GGTAGAAACCTGCCCTGGAGAGG - Intergenic
1159932138 18:74323966-74323988 GGTGGGCACCAGCCCTGCACAGG - Intronic
1160033205 18:75279776-75279798 GGCAGGGCCCAGCCCGGGGCAGG - Intronic
1160626560 18:80212248-80212270 GGCAGGAACCAACCATGGGCAGG - Intronic
1161069593 19:2253495-2253517 TGCAAGACCCAGCCCTGGAGAGG + Intronic
1161145707 19:2676932-2676954 GGTGGAAATCAGCCCTGGACAGG - Intronic
1161965119 19:7543490-7543512 GCCATGAACCAGCCCTGGGTCGG + Intronic
1162813919 19:13181781-13181803 GGCAGGACTCAGCCCAAGACCGG - Intergenic
1162922167 19:13909663-13909685 GGCTGGAACAAGCCCAGAACAGG - Intronic
1162939080 19:13997288-13997310 GTAAGAAACGAGCCCTGGACGGG + Intronic
1163390742 19:17028310-17028332 GGCAGCACCAAGCCCTGGGCTGG + Intergenic
1163608384 19:18288160-18288182 GGCAGACACCTGCGCTGGACTGG - Intergenic
1163630664 19:18416646-18416668 GCCAGGAAGCAGCCGTGGCCGGG - Intergenic
1163817467 19:19475519-19475541 GGCAGCAGCCAGCCCTCAACAGG - Intronic
1164618624 19:29681009-29681031 GTCAGCAAGCAGCCCAGGACAGG - Intergenic
1164692398 19:30221320-30221342 GGCAGGAACCAGCCCTGGACAGG + Intergenic
1164933036 19:32189868-32189890 GACAAGACCCAGCCCTGCACTGG + Intergenic
1165148535 19:33748063-33748085 GGCAGGAGGGAGCACTGGACGGG - Intronic
1165303779 19:34990506-34990528 GGCAGGAAATGGCCTTGGACTGG + Intergenic
1166046693 19:40234354-40234376 GGCGGGAGCCAGCCATGGAAGGG - Intronic
1167267304 19:48489967-48489989 GGCAGGTCCCAGCGCAGGACTGG - Intronic
1167982315 19:53285021-53285043 GGCAGGAAGCAGCCCTGTACGGG + Intergenic
1167983830 19:53298952-53298974 GGCAGGAAGCAGCCCTGTGCGGG - Intergenic
1168368930 19:55814854-55814876 GACAGCCACCAGCCCAGGACTGG + Intronic
1168445049 19:56404365-56404387 GCCAGGATCGAGCCCTGGCCCGG + Exonic
1168585095 19:57585288-57585310 GGCAGGACTCAGGCCTGGAATGG + Intronic
1168650081 19:58087091-58087113 GCTAGGAGCCAGCCCTGGCCAGG + Intronic
925551902 2:5085295-5085317 GGCAGGAACCAGCCCTGGACAGG - Intergenic
925651207 2:6091236-6091258 GGCAAGAATCAGCTCTGGACAGG - Intergenic
926005793 2:9372753-9372775 GGTGGGAACAAGCCCTGAACAGG + Intronic
926246156 2:11123594-11123616 GGCAGGAGCCACCCCTGGCCTGG - Intergenic
926415867 2:12649395-12649417 GGCAGTGACCAGGCCTGGGCAGG + Intergenic
927960165 2:27236279-27236301 GGCAGGTAACAGCTGTGGACTGG + Exonic
928441741 2:31297708-31297730 GGCAGGAACCAGACAAGGTCTGG - Intergenic
929252447 2:39774142-39774164 GGCGGGAACTAGCCCTGCATAGG - Intronic
929589493 2:43135802-43135824 GGCAGGAGCCTGGCCAGGACTGG + Intergenic
930140422 2:47946021-47946043 GGTGGGAACCAGCCTTGGACAGG + Intergenic
930353312 2:50285363-50285385 GGTAGAAACCAAGCCTGGACAGG + Intronic
930725764 2:54679903-54679925 AGTAAGAACCAGCCCTGAACAGG + Intergenic
930732642 2:54743165-54743187 GGTGGGAACCAGCCCTGGACAGG + Intronic
930757819 2:54995664-54995686 GGCAGGAACCAACCCTGGACAGG + Intronic
931065514 2:58581683-58581705 GGCAGGAACCAGCACTGGCCAGG - Intergenic
931591496 2:63888574-63888596 GGCAGGAGCCAACCCTGCACAGG + Intronic
931618228 2:64183331-64183353 GATGGAAACCAGCCCTGGACAGG + Intergenic
931862646 2:66372311-66372333 GGCGGAAACCAGCCCTGGCCAGG - Intergenic
931956280 2:67429195-67429217 GGTGGGAACCAGCCCTGACCAGG - Intergenic
932107687 2:68961676-68961698 GGTAGGAACCCACCCTGGACAGG - Intergenic
932289832 2:70567548-70567570 GGCAGGAACCAGCCCTGGACAGG + Intergenic
932682967 2:73842420-73842442 GGTGGGAACCAGCCCTGGAGAGG - Intronic
933048107 2:77564757-77564779 AGCAACAACCAGCCCTGGAAAGG + Intronic
933800829 2:85959061-85959083 GGTGGGGACCCGCCCTGGACAGG - Intergenic
934584497 2:95478784-95478806 TGCAGGACCCATCACTGGACTGG - Intergenic
934594955 2:95597931-95597953 TGCAGGACCCATCACTGGACTGG + Exonic
934857800 2:97739716-97739738 GGGAGCCACCAGCCCAGGACAGG - Exonic
935084441 2:99830945-99830967 GGCAGGCACCAGCCCTGGCCAGG + Intronic
935424412 2:102904988-102905010 GGCGGGAACCAGTCCCGGATAGG + Intergenic
935502198 2:103855629-103855651 GGCAGGAGCCCACCCTGGACAGG + Intergenic
935526218 2:104171339-104171361 TGCAGGAACCAACCCTGAACAGG + Intergenic
935687839 2:105699845-105699867 GGAAGGATCTAGCCCTGGACTGG - Intergenic
936488633 2:112949714-112949736 GTCAGAAACCAGCCCTGGACAGG - Intergenic
937845039 2:126570289-126570311 GGCCAGAACCAGCCCCAGACAGG + Intergenic
937923076 2:127146113-127146135 GCCTGGGACCAGCCCTGGGCAGG + Intergenic
938585887 2:132690302-132690324 AGCAGGAACCAGCCCTGGACAGG - Intronic
938762782 2:134440526-134440548 GACGGGAAGCAGCCCTGGACAGG - Intronic
938786829 2:134637384-134637406 GGCGGGAACCAGCCCTGGATGGG - Intronic
938978575 2:136503982-136504004 GGCAGGAAGCAACCCTGGACAGG - Intergenic
938979818 2:136515592-136515614 GGCAGAAACCAGCCCTGGGCAGG - Intergenic
939148043 2:138440168-138440190 GGAGGGAACCAGCTTTGGACAGG + Intergenic
939355125 2:141091622-141091644 GGCAGGACCCAAACCTGGACAGG - Intronic
939364374 2:141213406-141213428 GTCAGGAACCAGCCCTGGACAGG + Intronic
940117719 2:150227442-150227464 AGCGGGAACCAGCCCCGGACAGG - Intergenic
940920517 2:159300763-159300785 GGCAGGAACCAACCCTGGACAGG + Intergenic
941996364 2:171605404-171605426 GGCAGGAACAAACCCTGTACCGG + Intergenic
942417761 2:175776690-175776712 GGAAGAAACCAGCGCTGGTCTGG + Intergenic
942894587 2:181036632-181036654 GGTGTGAACCATCCCTGGACAGG - Intronic
943488094 2:188514105-188514127 AGCTGGAAACAGCCCTAGACAGG - Intronic
944158420 2:196633730-196633752 GGCAGGAACCAGCCCGAGGCAGG - Intergenic
944280788 2:197894157-197894179 GGCAGGAACGGGGCATGGACAGG - Intronic
944288589 2:197978734-197978756 GGTGGGAACCAACCCTGGCCAGG + Intronic
945026207 2:205622177-205622199 GGCAGGAACCAGCCCCGGACAGG - Intergenic
945336350 2:208597379-208597401 GATAGGAACCCACCCTGGACAGG - Intronic
946176311 2:217923867-217923889 GCCAGGCATCAGCCCTGGTCTGG - Intronic
946434310 2:219641789-219641811 GGCAGAGCCCAGCCCTGGGCTGG + Exonic
946777807 2:223161858-223161880 GGCAGGACCCAATCCTGGCCAGG + Intronic
947659676 2:231857132-231857154 GGCGGGAACCAGCCCTGGACAGG - Intergenic
948211140 2:236193977-236193999 GGCAGGAACCAGGCCTGGACGGG - Intergenic
948735700 2:240003473-240003495 GGCAGGAAGCAGCACAGGGCAGG + Intronic
949030812 2:241796438-241796460 GGCAGGAGCCCTCCCTGGGCCGG + Intronic
949041664 2:241852486-241852508 TGCAGGACAGAGCCCTGGACTGG + Intronic
1168953323 20:1817400-1817422 GGCAGGCAGAAGCCCTGGACAGG + Intergenic
1168971721 20:1935819-1935841 GCCAGGTGCCAGCCCTGGCCAGG + Intronic
1169490165 20:6064569-6064591 GGCTGGAACCAGCCCTGGGCAGG + Intergenic
1171059013 20:21937813-21937835 GGTGGGAACCAGCCCTGAACAGG - Intergenic
1171568286 20:26217487-26217509 TGTGGGAACCAGCCCTGGACAGG + Intergenic
1172217091 20:33243349-33243371 GGTTGGAAACAGCCCTGGCCTGG + Intergenic
1172629244 20:36367127-36367149 GGCAGGAAGCAGCTTGGGACAGG - Exonic
1172894700 20:38292328-38292350 GGAAAGCACCAGCCCTGGCCTGG + Intronic
1173170089 20:40716692-40716714 GGCAGTACCCAACTCTGGACAGG - Intergenic
1174236474 20:49097347-49097369 GGCCGGATCCACCACTGGACTGG - Intergenic
1174246355 20:49184364-49184386 GGCCGGAACCAGTCCTGGACAGG + Intronic
1175257755 20:57657285-57657307 AGAAGGCACCAGCCCTGGAGGGG - Intronic
1176161686 20:63651941-63651963 GGCAGGAGGCGGCCCTGGAGAGG + Intronic
1176518948 21:7810606-7810628 GGCAGACACCAACCCTGGACAGG - Intergenic
1176907661 21:14522852-14522874 GGCAGGAACCAGCCCTGGACAGG + Intronic
1177032877 21:16004654-16004676 GACAGGAACCAACCCTAGACGGG + Intergenic
1177324856 21:19572314-19572336 GATGGAAACCAGCCCTGGACAGG + Intergenic
1177679838 21:24352690-24352712 GGCTGGAATCAACCTTGGACAGG + Intergenic
1178518626 21:33268551-33268573 CGGAGGAGCCAGCCCTGGGCTGG + Intronic
1178652976 21:34440619-34440641 GGCAGACACCAACCCTGGACAGG - Intergenic
1178959065 21:37047474-37047496 GAGAGGAACCAGCCGTGGATGGG - Intergenic
1179050910 21:37887982-37888004 GGCAGCAACAAGCCTTGGTCTGG - Intronic
1179125099 21:38583402-38583424 TGCAGGAGCCAGGGCTGGACTGG - Intronic
1179249008 21:39657306-39657328 GGCAGGCACCATCCATTGACTGG + Intronic
1179445714 21:41428875-41428897 GGCACAAACCTGCCCTGGGCAGG + Intronic
1180115449 21:45700705-45700727 GGCAGGTTACAGCCCTAGACAGG - Intronic
1180817816 22:18803234-18803256 GGCTGGAGCCAGCTCTGGACTGG - Intergenic
1181028079 22:20137145-20137167 GGCAGGTACCCGCACTGGGCAGG + Intronic
1181204031 22:21237687-21237709 GGCTGGAGCCAGCTCTGGACTGG - Intergenic
1181695261 22:24589790-24589812 GGCAGGCACGGGCCCTGGGCTGG - Intronic
1182192343 22:28475288-28475310 GGCAGGAAACCACCCTGGACAGG + Intronic
1182623980 22:31632664-31632686 GGCGGAAACCAGTCCTGGATGGG - Intronic
1183309884 22:37103619-37103641 GGCAGGCACCAGAGCTGGACTGG + Exonic
1183764056 22:39854014-39854036 GGTGGGAACCATCCCTGGACAGG + Intronic
1183937526 22:41271894-41271916 TGCAGGAAGCAGCCCAGGGCAGG - Intronic
1184021326 22:41823687-41823709 GGGAGGAACCAACCCTGGACAGG + Intronic
1184345258 22:43909129-43909151 AGCTGGAACCAGCCCTCAACAGG + Intergenic
1184722545 22:46323471-46323493 GGCAGCTCCCAGCCCTGGACTGG + Intronic
1184765843 22:46572046-46572068 GGCAGGAAGGAGCCATGGCCGGG - Intergenic
1184772726 22:46607427-46607449 GCCAGGAACCAGCCCTCCACAGG + Intronic
1184884052 22:47331427-47331449 GGCAGGTCCCAGCCCAGGACTGG + Intergenic
1184935677 22:47718682-47718704 GGCAGGAATCAGGCCAGGAGGGG - Intergenic
1185002727 22:48256143-48256165 GGGGGGAAACAGCCCTGCACTGG - Intergenic
1185102315 22:48847969-48847991 GGCAGGAACCAGCCCTGAACAGG + Intronic
1185212667 22:49579917-49579939 AGCAGAAACCAGCCTTGTACTGG + Intronic
1203222890 22_KI270731v1_random:57728-57750 GGCTGGAGCCAGCTCTGGACTGG + Intergenic
1203267939 22_KI270734v1_random:29085-29107 GGCTGGAGCCAGCTCTGGACTGG - Intergenic
949293126 3:2488485-2488507 AGCAGGAACCAACCCTGGAGAGG - Intronic
950093093 3:10311231-10311253 GGCAGAAGCCAGCCCTGGACAGG - Intronic
950339020 3:12225013-12225035 GGCAGGAGCCAGCCCCAGCCAGG - Intergenic
950895324 3:16444542-16444564 GGCAGGCGCCAGCCCTAGACAGG - Intronic
951146676 3:19234882-19234904 GGCAGAAACCCACGCTGGACAGG - Intronic
951515758 3:23557435-23557457 GACGGGAACCAACCCTGGACAGG + Intronic
952110572 3:30119427-30119449 GGCGGGAACCAGCCCTGGACAGG + Intergenic
953339315 3:42120465-42120487 GTCAGGAACCTGCACAGGACAGG - Intronic
953759132 3:45673144-45673166 GGTAGGAACCAGCACTGCATAGG - Intronic
954293161 3:49660397-49660419 GGCAGAACCCAGGCCTGGGCTGG - Intronic
954748546 3:52800786-52800808 GGCAGGACCCTGCCCTTGAGGGG - Intronic
954782440 3:53071564-53071586 AGCAGACACCAGCCCTTGACGGG + Intronic
955592544 3:60553021-60553043 GGGAGGAGCCCACCCTGGACAGG - Intronic
956208024 3:66773997-66774019 GACAGGAACCCACTCTGGACAGG + Intergenic
956238962 3:67107480-67107502 GGCACGAACCAGCCCCAGACAGG - Intergenic
957110562 3:75950846-75950868 TGTGGGAACCAGCCCTGGACAGG - Intronic
957162678 3:76630292-76630314 GGCAGGAACCAACCCTGGACAGG - Intronic
957622012 3:82605244-82605266 GGCAAGACCCAGCACTGGATTGG + Intergenic
958114688 3:89200904-89200926 GGCAGGAGCCAGCCCTGGACAGG - Intronic
958467299 3:94473448-94473470 GGCAGGAACAAACTCTGTACTGG + Intergenic
959488886 3:106962946-106962968 GACAGGAACCAGCTGTGGACAGG + Intergenic
959530787 3:107431681-107431703 GGCAGGGATGAGCCCTGGTCAGG + Intergenic
960044434 3:113183096-113183118 AGCAAGAACCAGCCCCGGACAGG + Intergenic
960942337 3:122943136-122943158 GGCAGGGACCAGGCAGGGACCGG + Intronic
961243918 3:125435255-125435277 GACAGGAACCAGCTCTGGCCTGG + Intergenic
961647453 3:128400211-128400233 GGTAGGAAGCTGCCCTGCACAGG - Intronic
961698445 3:128723139-128723161 GACAGGAACCAACCCTGCACAGG + Intergenic
961964596 3:130889088-130889110 GGGAGGAATCAACCCTGGACAGG + Intronic
962162884 3:133018213-133018235 GATGGGAACCAGCCCTGGACAGG + Intergenic
962563841 3:136636864-136636886 GGTAAGAACAAACCCTGGACAGG + Intronic
965510980 3:169567677-169567699 GTCAGGAAAGAGCCCTGGGCTGG - Intronic
965982029 3:174705107-174705129 GGCAGGAACCAGATCTGGACAGG + Intronic
967050407 3:185778212-185778234 GGCCAGAAGCAACCCTGGACAGG + Intronic
967408075 3:189139339-189139361 ACCCGGATCCAGCCCTGGACTGG + Intronic
967452102 3:189637048-189637070 GGTAGAAACCAACCCTGGACTGG + Intronic
967900531 3:194446433-194446455 GGCAGGAACCAGCCCTAGACAGG - Intronic
968468136 4:763346-763368 TGGAGGAACCAGCCCTGCGCTGG - Intronic
968584479 4:1409737-1409759 GGCAGGAACACGCCTGGGACAGG + Intergenic
968814623 4:2815468-2815490 GGCAGGAACGAGCCCCTCACAGG + Intronic
968911148 4:3477566-3477588 GGCAGGAGCCAGCCCTGTTGGGG + Intronic
968958803 4:3732409-3732431 GGCAGGCAACAGGCCTGGCCCGG - Intergenic
969204856 4:5635857-5635879 GGAAGGACCCAGCTCTGAACTGG + Intronic
969664477 4:8549236-8549258 GGCAGGCATCAGGGCTGGACAGG + Intergenic
969861084 4:10035706-10035728 GGCAGGCACCATCCATTGACTGG + Intronic
969978940 4:11134252-11134274 GGTGGAAACCAACCCTGGACAGG - Intergenic
970676544 4:18456783-18456805 GGCAGGAAGCAGTCCTGGGTAGG - Intergenic
971022515 4:22551643-22551665 GGCAGGAACCAGCCCTGGACAGG + Intergenic
971057159 4:22926555-22926577 GGCAGGAACCAGCCCAGGACAGG - Intergenic
971135562 4:23864486-23864508 AGCAGCAACCAGCCCTGGCAGGG + Intronic
971327002 4:25652854-25652876 GGTAGCAGCCAGCCCTGGATGGG + Intergenic
972057002 4:34815551-34815573 GGCAGGTACCAGCCCTGTGAAGG - Intergenic
972197150 4:36667652-36667674 GGTGAGGACCAGCCCTGGACAGG + Intergenic
972249054 4:37280355-37280377 GGTGGGAACCAGCCCTGCACTGG + Intronic
972757827 4:42067848-42067870 GGAAGGAACCAGACCTGGCCAGG - Intronic
973141000 4:46767990-46768012 GGCAGGAACGAACCCTGTACAGG + Intronic
975193276 4:71491594-71491616 GTCAGGAACTATCCCTAGACAGG - Intronic
975544526 4:75547740-75547762 GGTGGGAACCAGCCCTGGCCAGG + Intronic
976114456 4:81712018-81712040 GGTGGGAACCAGCCCTGGATGGG - Intronic
977343175 4:95786374-95786396 GGTGGGAACCAGCCCTGGCTAGG + Intergenic
977359484 4:95984354-95984376 GGCAGGAACAAATCCTGTACTGG + Intergenic
977415183 4:96723495-96723517 GGCAGGATCCAGCTCTTCACAGG + Intergenic
977560248 4:98525460-98525482 GGCAGGGACCCACCCTAGACAGG - Intronic
979259314 4:118633546-118633568 GGCAGGAGCTGGCCCTGGACAGG - Intergenic
981346670 4:143684120-143684142 GGGAGGAACCAGCAGTGGGCAGG - Intronic
981506301 4:145503897-145503919 GGTGGGAACCACCCCTGGACAGG - Intronic
981603436 4:146518021-146518043 GGCAGGGACCAGGCCTGGCTGGG - Intronic
982931850 4:161418209-161418231 GGGAGGAACCAGCCATGGACAGG - Intronic
984690500 4:182720323-182720345 GGCAGGAAACAGCACTGGAAAGG + Intronic
984760137 4:183356633-183356655 GGCGGGAACCAACCCCGGAGGGG - Intergenic
985987737 5:3531516-3531538 GACAGGTACCAGCCCTAGAGTGG + Intergenic
986061591 5:4196877-4196899 GGCGGGACACATCCCTGGACTGG + Intergenic
987671447 5:21015073-21015095 GGCGGGAACCAGCATTGGACAGG - Intergenic
987785598 5:22494367-22494389 GGCGGGAACCCGCCCCAGACAGG - Intronic
988066560 5:26233001-26233023 GGCAGGACCCAGCCCTGCGGGGG + Intergenic
988273062 5:29042273-29042295 GATGGGAATCAGCCCTGGACAGG + Intergenic
988888747 5:35590095-35590117 GACAGGAACCAGCCCTGGACAGG - Intergenic
989119524 5:37990402-37990424 GGCAGTAAACAGGCCTGGAGGGG - Intergenic
989651807 5:43698478-43698500 GGCAGGAACCAGATCTGGACAGG - Intronic
989969854 5:50510417-50510439 GGCAGGATCCAACCCTGGACAGG - Intergenic
990220437 5:53582378-53582400 GACAGGAACCAGCCCTGGACAGG + Intronic
990412339 5:55553437-55553459 GGCAGGAAGCAGCCCTAGACAGG - Intergenic
990497700 5:56365311-56365333 GGCAGGAACCAGCCCTGGACAGG + Intergenic
990498318 5:56370452-56370474 GGCAGTAACAAGTCCTAGACGGG - Intergenic
990956124 5:61341250-61341272 GGCAGGAACCCACCCTGGATGGG - Intronic
991081317 5:62603551-62603573 GACGGGAACCAGTCCTGGACAGG + Intronic
991123792 5:63046707-63046729 GGCAGGAACTAGCCCTGGACAGG + Intergenic
991219447 5:64195820-64195842 GGTGGGAACCAGCCCTGGACAGG + Intronic
991230235 5:64324259-64324281 GGCAGGAACCAGGCCTGGATGGG + Intronic
991406238 5:66303472-66303494 GATTGGAACCAGCCCTGGCCAGG - Intergenic
992203432 5:74406100-74406122 GGCAGACACCAACCCTGAACAGG - Intergenic
992209482 5:74463677-74463699 GGCAGGAACTGACTCTGGACAGG - Intergenic
992285410 5:75230117-75230139 GGCAGGAACCAACCCCGGACTGG - Intronic
992285425 5:75230177-75230199 GGCAGGAACCAACCCCGGACTGG - Intronic
992286330 5:75239302-75239324 GGCAGGAGCCAACCCAGCACAGG + Intergenic
992851021 5:80807753-80807775 GGCAGGAACCAGCCCTGGACAGG + Intronic
993244869 5:85437978-85438000 GGCAGGAACTAGCCCTGGACAGG + Intergenic
993383409 5:87233911-87233933 GGCAGGAACCAGCCCTGGAGAGG - Intergenic
993673689 5:90792823-90792845 GGCAGGGATCAACCCTGGACAGG + Intronic
993689474 5:90981619-90981641 GGCAGGAACCAGCCCTGGACAGG - Intronic
993729943 5:91410602-91410624 GGCGGAAACCAGCCCTGGCCAGG + Intergenic
993896177 5:93538055-93538077 GGAAGGAACTAGCCCTAGACAGG - Intergenic
994599547 5:101885833-101885855 GGCAGTAACCAATCCTGGACAGG + Intergenic
994632767 5:102306601-102306623 AGCAGGAAGCAGCCCTGGACAGG + Intergenic
994896147 5:105705931-105705953 GGCAGAAACCATCCCTGAACCGG - Intergenic
995105219 5:108369983-108370005 GGTAGGAACCAGCAATGGACAGG + Intronic
995120174 5:108527674-108527696 GGCAGGAACCTGCCCTGGCCAGG - Intergenic
996340964 5:122438403-122438425 GGCGGGAACCATCCCTGGACAGG - Intronic
997028665 5:130096793-130096815 GGAAGTAACCAGCTCTGTACTGG - Intronic
997250200 5:132382648-132382670 GGAAGGAAGCTACCCTGGACTGG - Intronic
997528341 5:134567574-134567596 GTCAGGAAATAGCCCTGGGCAGG + Intronic
997714889 5:136035128-136035150 GCCATGGACCTGCCCTGGACAGG - Intronic
997760951 5:136446689-136446711 GGGAGGAACCAGCGGTGGGCAGG - Intergenic
997929159 5:138058206-138058228 GGCAGGAACCAGCTCGGGACAGG + Intergenic
998069420 5:139185247-139185269 GGCAGGAACCAGCCTTGGACAGG - Intronic
999073885 5:148776918-148776940 GGCAGGAGCCAGCCCTGTACTGG + Intergenic
999341298 5:150776080-150776102 GGCAGTAACCAGCCCTGGACAGG + Intergenic
999345745 5:150817466-150817488 GGCAAGAACCAGCTCTGTTCTGG + Intergenic
999967460 5:156824760-156824782 GGTAGAAACCACCCCTGAACAGG + Intergenic
1001071685 5:168590863-168590885 GGCAGGCACTAGCCCTGGACAGG - Intergenic
1001207887 5:169781061-169781083 GGCGGAAACCAGCCTTGGACAGG + Intronic
1001306137 5:170574722-170574744 GGAAGGAACCCACCCTGGCCAGG + Intronic
1002708209 5:181177581-181177603 CGCAGAATACAGCCCTGGACAGG + Intergenic
1002729447 5:181324807-181324829 GGCAGGAGCTGGGCCTGGACAGG - Intergenic
1002793948 6:455925-455947 GGCAGGAACCAACCCTGGTGAGG + Intergenic
1002795031 6:465302-465324 GGCAGGAAGCAGGCAGGGACAGG + Intergenic
1002959755 6:1903965-1903987 GGCAGGCTCCAGTTCTGGACAGG + Intronic
1003459070 6:6313229-6313251 GCCAGGAACTAGGCTTGGACAGG - Intronic
1004188352 6:13441920-13441942 GGAGAGAACCAGCCCTGGACAGG + Intronic
1004813886 6:19291429-19291451 GGCAGGAACCAGCCCTGAACAGG + Intergenic
1004929246 6:20445925-20445947 GCAGGGCACCAGCCCTGGACAGG + Intronic
1005189544 6:23204601-23204623 GGCAGGAACCAGCCCTGGCCAGG + Intergenic
1005231161 6:23703320-23703342 GGCAGGAACCAATCTTGGATAGG - Intergenic
1005392616 6:25349142-25349164 GGTGGGAACCAACTCTGGACAGG + Intronic
1006025339 6:31143203-31143225 CCCAGGAACCAGCCCAGGATGGG + Intronic
1006132997 6:31879889-31879911 GGGAGGAACCAGCTCTGGGAGGG + Exonic
1006422249 6:33942354-33942376 GGTCTGAACCAACCCTGGACTGG - Intergenic
1006741417 6:36311754-36311776 GGCAGGGAGCAGACCTGGATAGG - Intergenic
1006827606 6:36947671-36947693 GGTGGGAACCTACCCTGGACAGG + Intergenic
1006903327 6:37516823-37516845 GGCAGGGAGCAGCACGGGACAGG - Intergenic
1006968058 6:38010150-38010172 GGTGAGAACCAGCCCTGGACAGG + Intronic
1006985956 6:38175777-38175799 ATCAGGAACCAGCTCAGGACAGG - Intronic
1007390252 6:41546537-41546559 GGCCGGAACCAGGGCTGGGCCGG + Exonic
1008114284 6:47529466-47529488 GGTAGGAACCATCCCTGGACAGG - Intronic
1008922354 6:56855744-56855766 GGCAGGAACCACACCTGGACAGG + Intronic
1009634227 6:66243290-66243312 GGCAGGAACAAAGCCTCGACAGG + Intergenic
1009894829 6:69735196-69735218 GGCAGGAACCAACACTGGACAGG + Intronic
1010187777 6:73162965-73162987 GGCAGCTAACAGCCATGGACAGG - Intronic
1010236513 6:73579491-73579513 GGCAGGAAGCTGTCCTGGACAGG + Intergenic
1010890862 6:81308758-81308780 GTCAGGAATCAGCCCTGCAAAGG + Intergenic
1011113273 6:83861678-83861700 GGCAGGAACCGACCTTGGACAGG - Intronic
1011785728 6:90842421-90842443 GGCAGGAACCCAACCTGGCCAGG - Intergenic
1012248309 6:96952129-96952151 GGCGGGAACCCATCCTGGACAGG - Intronic
1012310748 6:97721362-97721384 AGTAAGAACCAGCCCTGGACAGG + Intergenic
1012424527 6:99099379-99099401 GGTAGGAAACAGCAGTGGACAGG + Intergenic
1012853065 6:104470046-104470068 GGCAGGAACCCACACTGGAAAGG + Intergenic
1014427043 6:121320954-121320976 GGTGGGAACCAGCCCTAGGCAGG - Intronic
1014621460 6:123673095-123673117 GGCAGAAACCAGCCCTGGTCAGG + Intergenic
1014635586 6:123843029-123843051 GGCAGGAATGAACCCTGTACCGG + Intronic
1015754218 6:136591360-136591382 GGCGGGCACCCGCCCTGGAAAGG - Intronic
1016192195 6:141283571-141283593 TGCGGGAGCCAACCCTGGACAGG - Intergenic
1016278690 6:142386797-142386819 GGCAGAAACTAGCCCTGGCCAGG + Intronic
1017032164 6:150233856-150233878 GGCAGGAACCAGCCCTGCAAAGG + Intronic
1017111376 6:150936281-150936303 GGCAGGGAGAAGCCCTGGGCAGG + Intronic
1017251213 6:152281927-152281949 GGCAGGAACAGGCCCTGCAGAGG - Exonic
1017344265 6:153361669-153361691 GGCAGGAAAATGCCCCGGACAGG - Intergenic
1017753588 6:157510895-157510917 GGCAGGAAGCAGCCCCGGTATGG - Intronic
1018670465 6:166172654-166172676 GGGTGAAACCAGCCCTTGACTGG + Intergenic
1019199706 6:170304657-170304679 AGCAGGAAGCAGAGCTGGACTGG - Intronic
1019301153 7:304173-304195 GGCTGAGCCCAGCCCTGGACGGG - Intergenic
1019501529 7:1367203-1367225 GGCAGGATCCAGGCCTGAAGGGG - Intergenic
1019667213 7:2257878-2257900 GGAAGGAACCGGCCCAGGCCAGG - Intronic
1019735149 7:2646821-2646843 GGCAGGAAGCGGCGCTGGAGGGG - Intronic
1020111192 7:5448649-5448671 GGCCAGATCCACCCCTGGACAGG + Intronic
1020380271 7:7537199-7537221 GGCAGGAACCAGCCCTGGACAGG + Intergenic
1020392050 7:7668862-7668884 AGGAGGAACCAGCTCTGGACAGG + Intronic
1021232602 7:18103953-18103975 GTTGGGAACCAGCCCCGGACAGG + Intronic
1021489597 7:21204220-21204242 GTTAGGAACCAGCCCTGGACAGG - Intergenic
1021548342 7:21841643-21841665 GGTGGGAACCAGCCCTGGACAGG - Intronic
1022173750 7:27853480-27853502 GGCAAGAACCAACTCTGGACAGG - Intronic
1022283526 7:28933782-28933804 TGCAGGCACCAGCCCTCGAAGGG + Intergenic
1022390223 7:29937387-29937409 CACAGTAACCAGCCCTGGACTGG + Intronic
1022508777 7:30922373-30922395 GGCAGGGTCCTGCCCTGGAGAGG + Intronic
1023109672 7:36796579-36796601 GACAGGAACCCGCCCCGGACAGG - Intergenic
1023384265 7:39639781-39639803 GGCTGGAACCAGCCTTGAACAGG + Intronic
1023400758 7:39792077-39792099 GGCAGGAGCTGGCCCTGGACAGG - Intergenic
1024074223 7:45810592-45810614 GGCAGGAGCTGGCCCTGGACAGG - Intergenic
1024153632 7:46598359-46598381 GGCAGAAACCAGCCCTGAACAGG - Intergenic
1024323033 7:48088760-48088782 GCGTGGAACCAGCCCTGGCCCGG - Exonic
1024490920 7:49985103-49985125 GGTGGGAACCAACGCTGGACAGG - Intronic
1024610366 7:51059065-51059087 GGTAGAAGCCAGCCCTGGACTGG - Intronic
1024649562 7:51391956-51391978 GGCAGGAACTGGGCCTGGAGAGG + Intergenic
1024976539 7:55118756-55118778 GGCGGGAACCAGGACTGCACAGG + Intronic
1025053190 7:55744936-55744958 GGCTGGAGCTGGCCCTGGACAGG + Intergenic
1025131291 7:56375409-56375431 GGCAGGAGCTGGCCCTGGACAGG + Intergenic
1025176331 7:56804205-56804227 GGCAGGAGCTGGCCCTGGAGGGG - Intergenic
1025177807 7:56810790-56810812 GGCAGGAGCTGTCCCTGGACAGG + Intergenic
1025178396 7:56813190-56813212 GGCAGGAGCTGTCCCTGGACAGG + Intergenic
1025178826 7:56814932-56814954 GGCAGGAGCTGTCCCTGGACAGG + Intergenic
1025179263 7:56816722-56816744 GGCAGGAGCTGTCCCTGGACAGG + Intergenic
1025179721 7:56818608-56818630 GGCAGGAGCTGTCCCTGGACAGG + Intergenic
1025180170 7:56820446-56820468 GGCAGGAGCTGTCCCTGGACAGG + Intergenic
1025180641 7:56822428-56822450 GGCAGGAGCTGTCCCTGGACAGG + Intergenic
1025181086 7:56824275-56824297 GGCAGGAGCTGTCCCTGGACAGG + Intronic
1025181515 7:56826017-56826039 GGCAGGAGCTGTCCCTGGACAGG + Intronic
1025181960 7:56827859-56827881 GGCAGGAGCTGTCCCTGGACAGG + Intergenic
1025182104 7:56828481-56828503 GGCAGGAATTGGCTCTGGACAGG + Intergenic
1025689825 7:63748514-63748536 GGCAGGAATTGGCTCTGGACAGG - Intergenic
1025690398 7:63750963-63750985 GGCAGGAGCTGTCCCTGGACAGG - Intergenic
1025690846 7:63752786-63752808 GGCAGGAGCTGTCCCTGGACAGG - Intergenic
1025691286 7:63754561-63754583 GGCAGGAGCTGTCCCTGGACAGG - Intergenic
1025691725 7:63756385-63756407 GGCAGGAGCTGTCCCTGGACAGG - Intergenic
1025692172 7:63758208-63758230 GGCAGGAGCTGTCCCTGGACAGG - Intergenic
1025692619 7:63760031-63760053 GGCAGGAGCTGTCCCTGGACAGG - Intergenic
1025693034 7:63761710-63761732 GGCAGGAGCTGTCCCTGGACAGG - Intergenic
1025693480 7:63763533-63763555 GGCAGGAGCTGTCCCTGGACAGG - Intergenic
1025693927 7:63765372-63765394 GGCAGGAGCTGTCCCTGGACAGG - Intergenic
1025695462 7:63772217-63772239 GGCAGGAGCTGGCCCTGGAGGGG + Intergenic
1025912507 7:65839839-65839861 GGCAGGAACTGGGCCTGGAGAGG - Intergenic
1025912693 7:65840771-65840793 GGCAGGAGCTGGGCCTGGACAGG - Intergenic
1025976980 7:66377426-66377448 GGCAGGAGCCGGGCCTGGAGCGG + Intronic
1026045190 7:66902148-66902170 GGCAGGAACTTGGCCTGGAAGGG - Intergenic
1026299644 7:69086167-69086189 GTCAAGAACCAGCCTTGGCCAGG + Intergenic
1027334571 7:77134770-77134792 CTCAGGTACCAACCCTGGACAGG - Intronic
1028655455 7:93200890-93200912 GGCCGGAACTAGCCCTGGACAGG + Intronic
1029781275 7:102736838-102736860 CTCAGGTACCAACCCTGGACAGG + Intergenic
1029894307 7:103966279-103966301 GGTGGGACCCAGCCCTGCACAGG + Intronic
1031147841 7:118016790-118016812 GGGAGGAACCAGCGGTGGGCAGG - Intergenic
1031603424 7:123741118-123741140 GGCAAGAACCAACCCTGGACAGG - Intronic
1032044511 7:128593280-128593302 AGCAGAAACCAAACCTGGACAGG - Intergenic
1032069581 7:128795500-128795522 GCCAGGAAGCAGGCCTGGACAGG + Intronic
1032798830 7:135301653-135301675 GGCTGCATCCAGCCCTGGCCTGG - Intergenic
1032810396 7:135408604-135408626 GGCAGGAACCAACCTTGGCAGGG + Intronic
1033650834 7:143342126-143342148 GGCTGGAACCAGCTCAGGTCAGG + Exonic
1033870299 7:145746119-145746141 GATGGGCACCAGCCCTGGACAGG + Intergenic
1034273545 7:149814542-149814564 GGCAGGCACAGGCCCTGGAGCGG - Intergenic
1034464284 7:151217197-151217219 GACAAGAACCAGCCCTGAAGAGG + Intronic
1034823047 7:154234815-154234837 CACAGGAACCAGGCCTGGACGGG - Intronic
1035078829 7:156199429-156199451 CCCAGGAACCAGCTCTGGAAGGG - Intergenic
1035420186 7:158723470-158723492 GGAAGGAGCCAGGCCTGAACGGG + Intergenic
1035952381 8:4037018-4037040 GGTGGTCACCAGCCCTGGACAGG - Intronic
1036533491 8:9620555-9620577 GGCAGGAGCCAGATCAGGACAGG - Intronic
1036613874 8:10373600-10373622 GGCAGGAACTGGGCCTGGAAGGG + Intronic
1036638644 8:10568380-10568402 TGCAGGCAGCAGCCCTGGAAGGG + Intergenic
1036722049 8:11185147-11185169 GGCGGGCACCAGTCCTGGACAGG - Intronic
1037136683 8:15470870-15470892 GGCAGGAACCAGCCCTGGCCAGG - Intronic
1037235359 8:16714007-16714029 GTCAAGAACCAGCCCTGTCCAGG + Intergenic
1037684578 8:21127977-21127999 GGCAAGAGCCAGCCCTGGACAGG - Intergenic
1037904908 8:22710554-22710576 GGCTGAAGCCAGCCCTGGCCAGG - Intergenic
1037928734 8:22865133-22865155 GGGAAGAACCAGTGCTGGACGGG + Intronic
1038411251 8:27361542-27361564 GGAAAGAGCGAGCCCTGGACTGG + Intronic
1038683936 8:29697934-29697956 GGCAGGAACCACCCCTGGCCAGG - Intergenic
1040804311 8:51377529-51377551 GGCAGGAACCGGGGCTGCACAGG + Intronic
1041088286 8:54278171-54278193 GACAGAAACCAGCCCAGGTCAGG + Intergenic
1041164196 8:55074620-55074642 GGTAGGAACCAGCCCTGGATAGG - Intergenic
1041305635 8:56455546-56455568 GGCAGGAACCAACCCTGGACAGG + Intergenic
1041512875 8:58670976-58670998 GGCAGGAGGCAGGCCTGGGCTGG - Intergenic
1041821104 8:62033685-62033707 GGTGGGAACCAGCCCTGAGCAGG - Intergenic
1042058210 8:64788560-64788582 GGCAGGAGCCAGCCCTTGACAGG - Intronic
1042097437 8:65232782-65232804 GGCAGGAACCTACCATGGACAGG - Intergenic
1042887178 8:73564966-73564988 GGCAAGAACCAACTCTGGACAGG - Intronic
1043390449 8:79786566-79786588 GGCGGGAACTAACCCTGGACAGG + Intergenic
1043867611 8:85394072-85394094 GGAAGCTGCCAGCCCTGGACAGG + Intronic
1043910228 8:85855317-85855339 GGCAGAAACCCACCCTGGACAGG - Intergenic
1045011007 8:97958331-97958353 TGCTGGAACCAGCTCTGGAAGGG - Intronic
1045192836 8:99899784-99899806 GGTAGGAACCAATCCTGGACAGG - Intergenic
1045848517 8:106665152-106665174 GGTGGGAACCAGCCCTAGACGGG + Intronic
1046621497 8:116533435-116533457 GGCCAGAACCAGCCCTGGACGGG + Intergenic
1047028264 8:120848418-120848440 GTGAGGCACCAGGCCTGGACTGG + Intergenic
1048027236 8:130597924-130597946 GGCAGCTACCAACCCTGGAGAGG - Intergenic
1048511176 8:135064211-135064233 GGCAGGTACCAGCCAAGGACTGG - Intergenic
1048784932 8:138040357-138040379 GGCATGAACCAGCCTGGGACAGG - Intergenic
1049130514 8:140835978-140836000 GTCAGGAGCCAGCCTTGGACAGG - Intronic
1049309408 8:141925410-141925432 GGCAGGAAGTAGCCATGGAGGGG - Intergenic
1050307190 9:4316687-4316709 GGCAGGAACCAACTCTGGGCAGG - Intronic
1050378097 9:4993987-4994009 GGTGGGAACCAACCCTAGACAGG - Intronic
1050808247 9:9711040-9711062 GGTGGGAACCAACTCTGGACAGG - Intronic
1050868456 9:10535058-10535080 GGCAGGTACCAACAGTGGACTGG + Intronic
1051356177 9:16241512-16241534 TACAGGAAACAGCACTGGACTGG - Intronic
1051419356 9:16874490-16874512 GGCAGGAACCAACCCTGGACAGG - Intergenic
1052700009 9:31926245-31926267 GGCAGGAACAAACCCTGTACAGG - Intergenic
1052955939 9:34253359-34253381 AGCAGGAAGCAGCTCAGGACAGG - Exonic
1053246386 9:36537949-36537971 GGCTGGAACCTGCCCTGGACTGG + Intergenic
1053273761 9:36767843-36767865 GGCAGAACCCAGCCCAGGACTGG - Intergenic
1053643060 9:40106501-40106523 GGCTGAGACCAGCCCTGGCCAGG - Intergenic
1053763087 9:41358987-41359009 GGCTGAGACCAGCCCTGGCCAGG + Intergenic
1054323909 9:63703728-63703750 GGCTGAGACCAGCCCTGGCCAGG - Intergenic
1054541697 9:66270102-66270124 GGCTGAGACCAGCCCTGGCCAGG + Intergenic
1055934271 9:81590297-81590319 GGGTGGAACCACCCCTGGGCAGG + Intronic
1056946035 9:90997734-90997756 GGCGGGAACCAGCCCTGAATAGG - Intergenic
1058128637 9:101224858-101224880 TGGAGGAACCAGCCCTGGACAGG - Intronic
1058247932 9:102654128-102654150 GGTGAGAGCCAGCCCTGGACAGG + Intergenic
1058899672 9:109431101-109431123 GGCAGGGGCCAGGCCTCGACAGG + Intronic
1059280137 9:113125827-113125849 GGCAGCACCCAACCGTGGACTGG - Intergenic
1059729956 9:117046943-117046965 GGCAGGAACCAAACCTTGCCAGG - Intronic
1060024853 9:120162292-120162314 AGCAGGGACCAGCTCTGGAAAGG - Intergenic
1060875692 9:127082033-127082055 GGCCTGAACCAGCCCTAGTCTGG - Intronic
1061644998 9:131993941-131993963 GGCAGAAACCAACCCTGGACAGG - Intronic
1061711512 9:132491049-132491071 GGCAGGCACCGACCCTGGACAGG - Intronic
1061943275 9:133894260-133894282 GGCCGGCACCATCCCTGGCCAGG - Intronic
1062113561 9:134795836-134795858 AGCAGGAACCCGCTCTGGAGTGG - Intronic
1062263437 9:135675169-135675191 TGCAGGAACCCGACCTGCACAGG - Intergenic
1062288301 9:135783417-135783439 GGCTGGATCCAGGCCTGGGCAGG - Intronic
1062344318 9:136107922-136107944 GGCAGCCCCCACCCCTGGACAGG + Intergenic
1062389714 9:136329125-136329147 GGCAGGAGCCAGCCCCTGGCAGG + Intronic
1062482936 9:136760762-136760784 GGCAGGACCCTGCCCTGGGGAGG + Intronic
1062610283 9:137370405-137370427 GGGAGGAACGAGCCCGGGGCTGG + Intronic
1203577418 Un_KI270745v1:20076-20098 GGCAGGAGCTGGGCCTGGACAGG - Intergenic
1186007175 X:5085464-5085486 GGAGGGAACCAGCCACGGACAGG - Intergenic
1186346848 X:8702685-8702707 GGCAGGAGCCAACTCTGCACAGG - Intronic
1187716815 X:22110858-22110880 GGCAGGATCCAGCCCTGGCTAGG + Intronic
1187803599 X:23093420-23093442 AGGAGGAACCAACCCTGGCCAGG + Intergenic
1187826728 X:23338675-23338697 GGCTAGAACCAGGACTGGACTGG + Intronic
1187968041 X:24632003-24632025 GGTGGGAACCAGACCTGAACAGG - Intronic
1188438157 X:30186051-30186073 GGCAGGAATGAACCCTGTACTGG - Intergenic
1188727148 X:33599826-33599848 GGCAAGAACCAACCATGGACAGG + Intergenic
1188770608 X:34148673-34148695 GGCCGGAATCAGTCCTGGCCAGG + Intergenic
1188782539 X:34303296-34303318 GGCAAAAACCAGCCCTGGCAGGG - Intergenic
1189748122 X:44190892-44190914 GGTGGGAACCAGCCCTGGACAGG - Intronic
1189917151 X:45866648-45866670 GGCAGGAATCCACCCTGGACAGG - Intergenic
1191936635 X:66434192-66434214 AGCAGGCACCAGTCCTGAACAGG + Intergenic
1192361358 X:70442498-70442520 GGCAGGAACCAATCCTGGACAGG - Intergenic
1195070525 X:101274642-101274664 GGTAGGAACCAGCCTTGGATAGG - Intronic
1195094888 X:101493209-101493231 CCCAGGACCCAGCACTGGACTGG - Exonic
1196365706 X:114921387-114921409 GGCAAGAACTGACCCTGGACAGG - Intergenic
1197827283 X:130603362-130603384 GGTAGGAACCAGCCCTGGACAGG - Intergenic
1198064847 X:133086020-133086042 GGCTGGAACCAACCCTGGGCAGG - Intronic
1199111888 X:143945424-143945446 GGCAGGAACAAGTCCTGGCCTGG - Intergenic
1199456406 X:148034156-148034178 GGCAGTAACCTACCCTGGCCAGG - Intergenic
1199483008 X:148318581-148318603 GGCAGGGACCAACCCTGTTCAGG + Intergenic
1199780734 X:151056750-151056772 GGTAGGAACTGACCCTGGACAGG - Intergenic
1200091231 X:153637080-153637102 GGCAGTAAGAAGCCCTGGAAGGG + Intergenic
1200841881 Y:7790402-7790424 GGCAGGCACCAGCCCTGGACAGG - Intergenic
1201220754 Y:11767690-11767712 GGCAGAAACCAACCCTGGATGGG + Intergenic