ID: 1164692402

View in Genome Browser
Species Human (GRCh38)
Location 19:30221338-30221360
Sequence ACAGGATGCCATCTCATTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164692393_1164692402 20 Left 1164692393 19:30221295-30221317 CCTGTCTTAGCAACTCAGGGTGC No data
Right 1164692402 19:30221338-30221360 ACAGGATGCCATCTCATTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164692402 Original CRISPR ACAGGATGCCATCTCATTGC AGG Intergenic
No off target data available for this crispr