ID: 1164692638

View in Genome Browser
Species Human (GRCh38)
Location 19:30222599-30222621
Sequence AGCCCCGCAGACGGCCGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164692638_1164692651 24 Left 1164692638 19:30222599-30222621 CCTGCCCGGCCGTCTGCGGGGCT No data
Right 1164692651 19:30222646-30222668 GCGCGCTGTCTCTGCCCGGTGGG No data
1164692638_1164692646 -9 Left 1164692638 19:30222599-30222621 CCTGCCCGGCCGTCTGCGGGGCT No data
Right 1164692646 19:30222613-30222635 TGCGGGGCTCAGGCGGGGCTTGG No data
1164692638_1164692650 23 Left 1164692638 19:30222599-30222621 CCTGCCCGGCCGTCTGCGGGGCT No data
Right 1164692650 19:30222645-30222667 AGCGCGCTGTCTCTGCCCGGTGG No data
1164692638_1164692649 20 Left 1164692638 19:30222599-30222621 CCTGCCCGGCCGTCTGCGGGGCT No data
Right 1164692649 19:30222642-30222664 ATGAGCGCGCTGTCTCTGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164692638 Original CRISPR AGCCCCGCAGACGGCCGGGC AGG (reversed) Intergenic