ID: 1164694985

View in Genome Browser
Species Human (GRCh38)
Location 19:30236718-30236740
Sequence GACAAACGATTAGCTCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 143}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164694983_1164694985 8 Left 1164694983 19:30236687-30236709 CCAAGAAGACACAGTGGCTTTCT 0: 1
1: 0
2: 3
3: 33
4: 264
Right 1164694985 19:30236718-30236740 GACAAACGATTAGCTCAGCCAGG 0: 1
1: 0
2: 0
3: 5
4: 143
1164694977_1164694985 30 Left 1164694977 19:30236665-30236687 CCCTTTAATAACTACTGCCACCC 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1164694985 19:30236718-30236740 GACAAACGATTAGCTCAGCCAGG 0: 1
1: 0
2: 0
3: 5
4: 143
1164694978_1164694985 29 Left 1164694978 19:30236666-30236688 CCTTTAATAACTACTGCCACCCC 0: 1
1: 0
2: 1
3: 9
4: 110
Right 1164694985 19:30236718-30236740 GACAAACGATTAGCTCAGCCAGG 0: 1
1: 0
2: 0
3: 5
4: 143
1164694982_1164694985 9 Left 1164694982 19:30236686-30236708 CCCAAGAAGACACAGTGGCTTTC No data
Right 1164694985 19:30236718-30236740 GACAAACGATTAGCTCAGCCAGG 0: 1
1: 0
2: 0
3: 5
4: 143
1164694980_1164694985 13 Left 1164694980 19:30236682-30236704 CCACCCCAAGAAGACACAGTGGC 0: 1
1: 0
2: 3
3: 18
4: 198
Right 1164694985 19:30236718-30236740 GACAAACGATTAGCTCAGCCAGG 0: 1
1: 0
2: 0
3: 5
4: 143
1164694981_1164694985 10 Left 1164694981 19:30236685-30236707 CCCCAAGAAGACACAGTGGCTTT No data
Right 1164694985 19:30236718-30236740 GACAAACGATTAGCTCAGCCAGG 0: 1
1: 0
2: 0
3: 5
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164694985 Original CRISPR GACAAACGATTAGCTCAGCC AGG Intronic
900266505 1:1759888-1759910 GACAAAGGAGTGGCTCTGCCAGG + Exonic
902560206 1:17272659-17272681 TACAAAAAATTAGCTGAGCCTGG - Intronic
904182389 1:28675171-28675193 TACAAAAAATTAGCTCAGCGTGG - Intronic
908712322 1:67030349-67030371 GATAAAAGAATAGCTTAGCCAGG - Intronic
909458258 1:75875046-75875068 GACAAACAATTAGCTGGGCATGG - Intronic
909953351 1:81747454-81747476 TACAAACAATTAGCTGAGCATGG - Intronic
910834674 1:91496799-91496821 TAAAAAGGATTAGCTCAGCATGG - Intergenic
913157011 1:116109761-116109783 CACAGACGATTATCTCTGCCTGG + Intergenic
913504523 1:119504268-119504290 GTCAAAAGTTTAGATCAGCCTGG + Intergenic
915302457 1:154959344-154959366 TCCCAACGATTTGCTCAGCCAGG - Exonic
916826400 1:168445825-168445847 GACAACTGATAAGCTCAGTCTGG - Intergenic
921090620 1:211838707-211838729 TACAAAAAATTAGCTCAGCATGG + Intergenic
921145700 1:212354026-212354048 TACAAAAAATTAGCTGAGCCTGG + Intronic
921703782 1:218296488-218296510 TACAAAAAATTAGCTCAGCGTGG + Intronic
923846956 1:237744955-237744977 TACAAAAAATTAGCTTAGCCGGG - Intronic
1066411554 10:35175288-35175310 TACAAACAATTAGCTGAGCGTGG + Intronic
1069918998 10:71805083-71805105 GAAAAATGATCAGCTCAGCATGG - Intronic
1074541786 10:114371213-114371235 GCCAAACGCTTTGCTCAGCCTGG + Intronic
1075588440 10:123674251-123674273 GAAAAACCATGAGCTCGGCCTGG - Intronic
1075842401 10:125516143-125516165 TACAAAAAATTAGCACAGCCTGG + Intergenic
1080735880 11:35013134-35013156 TACAAACGATTAGCTGGGCGTGG + Intronic
1082677151 11:56119192-56119214 TACAAAAAATTAGCTGAGCCTGG + Intergenic
1082849733 11:57754191-57754213 GAAAAACAATTAAATCAGCCAGG - Intronic
1089467859 11:118697162-118697184 CACAGAGGCTTAGCTCAGCCAGG + Intergenic
1091624816 12:2113762-2113784 GCCAAGCGATCAGCTCAGCCTGG - Intronic
1094535534 12:31319370-31319392 TACAAAAAATTAGCCCAGCCTGG + Intronic
1097676133 12:62603685-62603707 CACAAACTACTACCTCAGCCAGG - Exonic
1099442295 12:82713163-82713185 GACAAAAGATTAGCTGGGCGTGG + Intronic
1100235807 12:92659680-92659702 GACAAAAAATTAGCTGAGCATGG - Intergenic
1101654481 12:106707976-106707998 GACAAAAAATTAGCTGAGCGTGG + Intronic
1102265659 12:111482348-111482370 TACAAACAATTAGCTGAGCGTGG - Intronic
1102355563 12:112231885-112231907 GACTAACCATTATCTCAGCCTGG - Intronic
1103573904 12:121862834-121862856 TACAAAACATTAGCTGAGCCAGG - Intronic
1103674637 12:122645757-122645779 TACAAACAATTAGCTGAGCGTGG + Intergenic
1103814182 12:123640012-123640034 TACAAACAATTAGCTGAGCATGG - Intronic
1104636159 12:130438871-130438893 GCCACACGATTAGCTCAGAGAGG + Intronic
1107793333 13:44025018-44025040 CACAACAGATTAGCTCAGCAAGG + Intergenic
1107936212 13:45347225-45347247 TACAAAAAATTAGCTGAGCCTGG + Intergenic
1109321824 13:60819254-60819276 GAGAAAAGGGTAGCTCAGCCAGG - Intergenic
1113731319 13:112643650-112643672 CACAAAAAATTAGCTGAGCCTGG - Intergenic
1113901991 13:113802658-113802680 GACTAAAAATTAGCTCAGCTGGG + Intronic
1114733484 14:25019104-25019126 GACAAATGATTAGTTCATTCTGG - Intronic
1120518966 14:85503874-85503896 TACAAAAAATTAGCTCAGCGTGG + Intergenic
1121189178 14:92009511-92009533 TACAAACGACTAGGTCAGTCAGG + Intronic
1122223650 14:100259362-100259384 TACAAACGATTAGCTGGGCATGG + Intronic
1124351613 15:28959987-28960009 TACAAACAATTAGCTGGGCCTGG + Intronic
1127218449 15:56850036-56850058 TACAAAAAATTAGCTCAGCATGG + Intronic
1128049886 15:64654938-64654960 TACAAACAATTAGCTGAGCGTGG + Intronic
1128073846 15:64813911-64813933 GAAAAACAATTGACTCAGCCGGG + Intergenic
1136678105 16:31933202-31933224 TACAAAAAATTAGCTCAGCATGG - Intergenic
1138698706 16:58840354-58840376 CACAAACAATTAGCTGAGCATGG + Intergenic
1139661876 16:68426469-68426491 GACAAGCTACTAGGTCAGCCAGG - Intronic
1140056959 16:71533884-71533906 TACAAAAAATTAGCTGAGCCTGG + Intronic
1142143442 16:88482828-88482850 GCGGAACGATCAGCTCAGCCCGG - Intronic
1142293901 16:89207230-89207252 TACAAAAGATTAGCTGAGCATGG - Intergenic
1142873982 17:2840099-2840121 GACAAAACACTATCTCAGCCAGG - Intronic
1143755192 17:9061857-9061879 TACAAAAAATTAGCTCAGCGTGG - Intronic
1146257113 17:31398028-31398050 GACAAAAAATTAGCTGAGCATGG - Intronic
1146317006 17:31815205-31815227 TACAAACAATTAGCTGAGCATGG - Intergenic
1150260264 17:63783906-63783928 TACAAAAAATTAGCTGAGCCTGG + Intronic
1150628403 17:66858568-66858590 GACAAGCGTTAACCTCAGCCTGG - Intronic
1151891365 17:76952551-76952573 GAGAAAAGAATAGCTGAGCCAGG + Intergenic
1155495326 18:26436750-26436772 AACAAACTACTAGCTCATCCTGG - Intergenic
1155631693 18:27901616-27901638 CAGAAATGATTTGCTCAGCCAGG + Intergenic
1155850464 18:30768249-30768271 GAGAAAAGGTTAACTCAGCCTGG + Intergenic
1158622566 18:59045662-59045684 TACAAATGATTAGCTGAGCGTGG + Intergenic
1158992097 18:62879565-62879587 TACAAACAATTAGCCCAGCGTGG - Intronic
1159583030 18:70254512-70254534 GAAAAAGTATTTGCTCAGCCGGG + Intergenic
1160476681 18:79196293-79196315 TACAGAGGATTAGCTCTGCCTGG + Intronic
1161624597 19:5319044-5319066 GAGAAAGCATCAGCTCAGCCTGG + Intronic
1163680716 19:18680654-18680676 AACAAAAGATTAGTTCAGCTGGG - Intergenic
1163951046 19:20586713-20586735 CACAAACAATTAGCTGAGCATGG + Intronic
1164694985 19:30236718-30236740 GACAAACGATTAGCTCAGCCAGG + Intronic
1165403101 19:35614210-35614232 GAAACAGCATTAGCTCAGCCAGG + Intronic
1165635654 19:37337597-37337619 TACAAAAGATTAGCTGGGCCTGG - Intronic
1168356409 19:55702953-55702975 TACAAAAAATTAGCTTAGCCGGG - Intronic
1168499365 19:56880416-56880438 TACAAACAATTAGCTGGGCCTGG + Intergenic
926158397 2:10470885-10470907 CAGAAACTATTAGCTCAGCCTGG + Intergenic
929689500 2:44062642-44062664 TACAAAAAATTAGCTCAGCATGG + Intergenic
930139314 2:47935546-47935568 TACAAAAAATTAGCTGAGCCTGG - Intergenic
931662716 2:64582583-64582605 GTCAGACAATTAGCTCACCCAGG - Intronic
931927269 2:67086911-67086933 TACAAAAGATTAGCTGGGCCCGG + Intergenic
934749849 2:96786621-96786643 TACAAAAAATTAGCTCAGCGTGG + Intronic
934968900 2:98747143-98747165 TACAAAAAATTAGCTCAGCATGG + Intergenic
936553042 2:113466906-113466928 TACAAAAAATTAGCTGAGCCTGG + Intronic
938597231 2:132800610-132800632 GACAAAAGATCAACTCAGACAGG - Intronic
939881457 2:147636055-147636077 GGCAAAAGAATAGCTGAGCCTGG - Intergenic
940160172 2:150703391-150703413 GACAAAAAATTAGCCTAGCCTGG + Intergenic
940207026 2:151214211-151214233 CAAAAACAATTAGCTGAGCCTGG + Intergenic
946294327 2:218771826-218771848 TACAAAAAATTAGCTCAGCATGG - Intergenic
948490731 2:238311036-238311058 GACAAAAAATTAGCTGAGCATGG + Intergenic
1173211895 20:41040648-41040670 TACAAAAGATTAGCTGGGCCTGG + Intronic
1174798357 20:53541337-53541359 TACAAAAAATTAGCTCAGCATGG - Intergenic
1175751106 20:61498659-61498681 GACAAAAGATTAGACCACCCTGG - Intronic
1179091358 21:38268896-38268918 GACAAGCCTTGAGCTCAGCCTGG - Intronic
1181143992 22:20830925-20830947 GACAAAAAATTAGCTGAGCATGG - Intronic
1181550062 22:23632755-23632777 TACAAAATATTAGCTCGGCCTGG + Intergenic
952001227 3:28787857-28787879 TACAAAAAATTAGCTGAGCCTGG - Intergenic
952847421 3:37700136-37700158 GACAAAAAATTAGCTGAGCATGG - Intronic
954667874 3:52268341-52268363 TACAAACTACTACCTCAGCCTGG + Intronic
959765178 3:110018287-110018309 GAGAAGCGATTATCTCAGCTCGG - Intergenic
964356482 3:155855751-155855773 TACAAAAAATTAGCTCGGCCTGG + Intergenic
966537961 3:181055138-181055160 GACAAGCCACTAGCTCAGCTGGG - Intergenic
969109206 4:4831298-4831320 TACAAAAAATTAGCTGAGCCTGG + Intergenic
970385819 4:15555441-15555463 GATAAACTCTTAGCTCGGCCGGG + Intronic
973929663 4:55778914-55778936 GACAAAAGATTAACTCAGAGTGG + Intergenic
979292904 4:118997683-118997705 GACTAAAGATTTGCTCTGCCTGG - Intronic
981019760 4:140013198-140013220 GTCAAATGATTAGCTCATCAGGG + Intronic
983880793 4:172930120-172930142 TACAAAAAATTAGCTCAGCGTGG + Intronic
984069858 4:175096537-175096559 TACAAAAGATTAGCTGAGCTTGG + Intergenic
993933377 5:93971152-93971174 TACAAAAGATTAGCTGAGCGTGG - Intronic
995438830 5:112167365-112167387 GACAACCTATTAGCTCTCCCAGG + Intronic
995537233 5:113149481-113149503 GATAAATGAGTAGCTCAGCAAGG - Intronic
997267570 5:132504332-132504354 GACAAAAAATTAGCTGAGCGTGG - Intergenic
1002564532 5:180102547-180102569 TACAAATAATTAGCTCAGCATGG - Intronic
1002651007 5:180693679-180693701 GAGAAAGGATGAACTCAGCCTGG + Intergenic
1003071201 6:2946880-2946902 TACAAAAGATTAGCTGAGGCCGG + Intergenic
1004046798 6:12033029-12033051 GACAAACGATTGGTTAAGTCAGG - Intronic
1005526206 6:26652532-26652554 TACAAAAAATTAGCTGAGCCTGG + Intronic
1008356832 6:50564975-50564997 GACAAAATACTATCTCAGCCAGG + Intergenic
1011465342 6:87650207-87650229 TAGAAAAAATTAGCTCAGCCTGG - Intronic
1011677402 6:89748168-89748190 GACAAAAAATTAGCCAAGCCTGG + Intronic
1016268816 6:142263927-142263949 TACAAACAATTAGCTGAGCATGG + Intergenic
1018019433 6:159745611-159745633 GAAAAAAGATGAGGTCAGCCTGG + Intronic
1020132187 7:5564986-5565008 AACAAACAATTAGCTGAGCGTGG + Intergenic
1028930742 7:96410133-96410155 AGCAAACGAATAGCTCAGACTGG + Intergenic
1032193836 7:129778992-129779014 AGCAAACGAATGGCTCAGCCTGG + Intergenic
1032486544 7:132291948-132291970 GACAAAACATTAGCTGAGCCTGG - Intronic
1037267148 8:17076181-17076203 GACAAACAATTAGCTGGGCATGG - Intronic
1039998662 8:42558013-42558035 TACAAAAAATTAGCTCAGCATGG - Intergenic
1046731674 8:117732765-117732787 TACAAAAAATTAGCTGAGCCTGG - Intergenic
1048712150 8:137224462-137224484 CAAAAACGATTAGCTGAGCATGG + Intergenic
1049844177 8:144792149-144792171 GACTCACGATTAGCGCGGCCGGG + Intronic
1049899957 9:150280-150302 TACAAAAAATTAGCTGAGCCTGG - Intronic
1053172911 9:35903784-35903806 TACAAAAGATTAGCTGAGCATGG - Intergenic
1053743007 9:41160576-41160598 TACAAAAAATTAGCTGAGCCTGG - Intronic
1054348283 9:63990389-63990411 TACAAAAAATTAGCTGAGCCTGG - Intergenic
1054446010 9:65316758-65316780 TACAAAAAATTAGCTGAGCCTGG - Intergenic
1054484260 9:65704753-65704775 TACAAAAAATTAGCTGAGCCTGG + Intronic
1054853003 9:69867923-69867945 GTGGAATGATTAGCTCAGCCGGG - Intronic
1058644121 9:107114849-107114871 TACAAAGGATCAGCTCTGCCTGG - Intergenic
1059538555 9:115108049-115108071 GACAATCAATGAGCACAGCCAGG - Intronic
1189183929 X:39035022-39035044 TACAAAAAATTAGCTCAGCGGGG + Intergenic
1193743672 X:85248311-85248333 TACAAAAGATTAGCTGAGCGTGG + Intronic
1194062546 X:89222271-89222293 TACAAAAGATTAGCTGGGCCTGG + Intergenic
1197167938 X:123399238-123399260 GACAAATGATTAGCCTAGACAGG + Intronic
1199141159 X:144314399-144314421 TACAAACAATTAGCTAAGCATGG - Intergenic
1199342557 X:146698490-146698512 GACAAACAGCTATCTCAGCCAGG + Intergenic
1200716412 Y:6551248-6551270 TACAAAAGATTAGCTGGGCCTGG + Intergenic