ID: 1164695640

View in Genome Browser
Species Human (GRCh38)
Location 19:30241594-30241616
Sequence CAGTGTGGCTGGAGTAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 528
Summary {0: 1, 1: 1, 2: 10, 3: 69, 4: 447}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164695635_1164695640 17 Left 1164695635 19:30241554-30241576 CCTCTGAGACAGGACTGTGCTAG 0: 1
1: 0
2: 1
3: 17
4: 181
Right 1164695640 19:30241594-30241616 CAGTGTGGCTGGAGTAAAAAAGG 0: 1
1: 1
2: 10
3: 69
4: 447

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164695640 Original CRISPR CAGTGTGGCTGGAGTAAAAA AGG Intronic
900729096 1:4240347-4240369 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
900791702 1:4684983-4685005 CACTGTGGCAGGAGGAAAAAAGG + Intronic
900998500 1:6135577-6135599 CAGTGTGGCTGAGGAAAAGAGGG - Intronic
901155627 1:7136022-7136044 CAGTGTGGCTGGAGAAAAACAGG + Intronic
901155812 1:7137450-7137472 CAGTGTGGCTGGAGAAAAACAGG + Intronic
901245833 1:7730319-7730341 CCGTGTGGCTGGAGCACAGAGGG - Intronic
901706362 1:11076488-11076510 CAGTGGTGGTGGAGGAAAAACGG - Intronic
901820164 1:11823820-11823842 CAGTGTGGCTGGAGGTAAGAAGG + Exonic
902171986 1:14619156-14619178 CATTGTGCATGGAGTAAAACTGG - Intronic
902961170 1:19963713-19963735 CAGAGTGGCTGGAGTGAAGCGGG - Intergenic
903781223 1:25821031-25821053 CAGTGTGGCTGGAGGGCAAGGGG + Intronic
904213008 1:28898107-28898129 TGGTGTGGCTGGAGCACAAAGGG + Intronic
906176928 1:43782599-43782621 CAGTGTGGCTGAAGTAAAAGAGG - Intronic
906527436 1:46503089-46503111 CAGGGTGGCTGGAGCACAGATGG - Intergenic
907313599 1:53553837-53553859 CTGTGTGGCTGGAGCAGAACGGG + Intronic
907359831 1:53905590-53905612 CAGCGTGGATGGACTAGAAATGG - Intronic
909032569 1:70559748-70559770 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
909033896 1:70574669-70574691 CTGAGGGGCTGGAGTAGAAAGGG - Intergenic
909208923 1:72797806-72797828 TGTTGAGGCTGGAGTAAAAAGGG - Intergenic
909956436 1:81784922-81784944 CAATTTGGCAGAAGTAAAAAGGG + Intronic
911411097 1:97508404-97508426 CAGTGTGGCTGGCAAAAAATTGG + Intronic
911463738 1:98224210-98224232 CAGTGTGGCTGAAGCATAAAAGG + Intergenic
911770566 1:101735659-101735681 CAGTGCTGCTGGAGCATAAAGGG + Intergenic
911807007 1:102222964-102222986 CAGTGTGGCTAGAGTAAAGCAGG + Intergenic
911970262 1:104425925-104425947 CAGTGTGGCTAGAATAAAACAGG + Intergenic
911978488 1:104534547-104534569 CAGTGTGGCTAGGATAAAAGAGG + Intergenic
912109132 1:106318487-106318509 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
912207342 1:107523218-107523240 CTGTGTGGCTGGAGCAGAACAGG - Intergenic
913397654 1:118389747-118389769 TAGTGTGGCTGGAGTTATGAAGG - Intergenic
915030627 1:152877785-152877807 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
915044162 1:152997860-152997882 CAGTGTGGCTGGGCCAACAATGG + Intergenic
915113303 1:153578575-153578597 CAGTGTGGCTGGAGCATGGATGG + Intergenic
915364869 1:155309437-155309459 CAGTTTGGCTTGTGTAAAATAGG + Intronic
915744994 1:158149186-158149208 CAGTGTGGATGGAGAAAAGTGGG + Intergenic
916486758 1:165266393-165266415 CAGTGTGGCTGGGGCAAAGATGG + Intronic
916573695 1:166048970-166048992 CAGTGTGGCTGGAGTGGAATAGG - Intergenic
917043530 1:170832304-170832326 AAGTGTGGATGCAGTGAAAAGGG - Intergenic
918107268 1:181425699-181425721 CAGTGTGGCTGGGGTATGAGCGG - Intronic
918487342 1:185044120-185044142 CAATGTGGGGGGAGAAAAAAAGG - Intergenic
918862772 1:189853978-189854000 CAGTGAGGATGAAGAAAAAAAGG - Intergenic
918953744 1:191176907-191176929 CAGTGTGGCTAAAGTAGTAATGG - Intergenic
919569987 1:199236203-199236225 CAGTTTGGCTGGAAATAAAAAGG + Intergenic
920768693 1:208858952-208858974 CAGTGTGGTTGGAGTAAAGTGGG + Intergenic
920805024 1:209224872-209224894 CAGTGTGGTTGGAGCACAGAGGG - Intergenic
921108510 1:212009176-212009198 GAGTGTGGGTGGAGGAAAATTGG - Intronic
922252285 1:223860510-223860532 CAGGCTGACTCGAGTAAAAATGG - Intergenic
923748274 1:236723743-236723765 CACTGTGCCTGGCCTAAAAATGG + Intronic
924114558 1:240732363-240732385 CAGTGAGACTGGGTTAAAAAGGG - Intergenic
924210689 1:241764098-241764120 CAGTGTGGCTGGAGTAATACTGG + Intronic
924306914 1:242698861-242698883 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
924431260 1:243998626-243998648 CAGTGGTGCTGGATTAAGAAGGG - Intergenic
1064980647 10:21163119-21163141 CAGTGTGGCTGGAGAGAAGGAGG + Intronic
1065050470 10:21786757-21786779 CACTGTGCCTGGACTAAAACGGG + Intronic
1065204054 10:23341686-23341708 CAGTGTGGCTGGAGCAGAGAGGG - Intronic
1067224198 10:44364694-44364716 CAGTGTGGCTGGAGCAGAGAGGG + Intergenic
1067482113 10:46608640-46608662 CAGAGTAGCTTGAGCAAAAAAGG - Intergenic
1067612636 10:47733027-47733049 CAGAGTAGCTTGAGCAAAAAAGG + Intergenic
1067978937 10:51060065-51060087 CAGTGTTACTAGAGTTAAAAAGG - Intronic
1068430068 10:56919974-56919996 CAGAGTTGGTGGAGTAGAAATGG + Intergenic
1069024876 10:63528704-63528726 CACTGTGGCTGGAGTTATAATGG - Intronic
1069201500 10:65623178-65623200 CAGTATGGCAAGAGGAAAAAAGG - Intergenic
1069377849 10:67812236-67812258 CAGTGTGGCTGGAGGACACAAGG + Intronic
1069507986 10:69018841-69018863 CAGTGTGGCTGGAGCAGATAAGG + Intergenic
1070280631 10:75045660-75045682 CAGTGTGGCTGAAGTGGCAAGGG + Intronic
1070669271 10:78366700-78366722 CACTGTGGTTGGAGTAAAGGAGG - Intergenic
1070760254 10:79019795-79019817 CAGTTTGGCTAGAATTAAAAGGG - Intergenic
1071628061 10:87193270-87193292 CAGAGTAGCTTGAGCAAAAAAGG + Intergenic
1071959264 10:90793952-90793974 CAGTGTGGCTAGAATAAAGCAGG - Intronic
1072052935 10:91724476-91724498 TAGTTTGGCTGGAGGAAAATAGG - Intergenic
1072443064 10:95474263-95474285 CTGTGTGGCTGAAATAGAAATGG + Intronic
1072624792 10:97104305-97104327 CAGGGTCGCTGGAGTGAGAAAGG + Intronic
1072783490 10:98265856-98265878 CAGTGTGGGTGGAGGGAAAAGGG - Intronic
1073479582 10:103778018-103778040 CATGGTGGCTGAAGTTAAAAAGG + Intronic
1074300864 10:112232331-112232353 CAATGTGGCTGGGGTTACAAGGG + Intergenic
1075259127 10:120947911-120947933 CCGTGTGGCTGGAGCAAAAAAGG - Intergenic
1075383384 10:122037208-122037230 CGGTGTGGCTGGAGAAAAGTGGG + Intronic
1075945263 10:126427552-126427574 CAGCGTGGCTGGAATAAAGCAGG + Intronic
1076057465 10:127387216-127387238 CAGTGTGGCTGGAATGCAGAGGG - Intronic
1076082977 10:127600181-127600203 CAGTGTGGGTGGAAAAACAAGGG + Intergenic
1076447068 10:130523567-130523589 CAGCGTGGCTGGAATAAAGCCGG + Intergenic
1076876209 10:133217100-133217122 CAGTGTGGATGTAGTTAACACGG + Intronic
1077537750 11:3132585-3132607 CAGTGTGGCTGGAGCAGAGTGGG - Intronic
1077670899 11:4156737-4156759 CAGTGAGGTTGGAGAGAAAAAGG - Intergenic
1077828325 11:5835063-5835085 CAGTGGGGCTGGAGGAAAGAGGG - Intronic
1077965000 11:7120369-7120391 CTGTGGGGCTGGAGCTAAAAAGG + Intergenic
1078895074 11:15590837-15590859 CAGTGTGGCTGGAGTGGGTAGGG - Intergenic
1080476150 11:32593291-32593313 CAGTTTCACTGGAGTAAATAGGG - Intronic
1080708134 11:34718780-34718802 CAATGTGGCTGGAGCAGAACAGG + Intergenic
1081218901 11:40436421-40436443 GAGTGTGACTTGAGTAATAAAGG + Intronic
1086259166 11:84916795-84916817 CAGTGTGGCTGAAGAGAGAAAGG - Intronic
1087286587 11:96270923-96270945 CAGTGTGGCTAGAGTAAAGCAGG + Intronic
1087466284 11:98510513-98510535 CAGCGTGGATGCAGTAAAAAGGG - Intergenic
1088212640 11:107473557-107473579 CAGTGAGGCTGGAATAAAGTAGG - Intergenic
1088250751 11:107858999-107859021 CAGGGTGGCAGGAGGAGAAAGGG + Exonic
1088342141 11:108780265-108780287 CAGGGTGGCTGAAGTTAAAGAGG + Intronic
1088616915 11:111639886-111639908 CAAGGTGGCTGGGGAAAAAAAGG - Intronic
1088951587 11:114576695-114576717 TGGTGTGGATGCAGTAAAAAGGG + Intronic
1088962299 11:114681121-114681143 CAATGTGGATGGAGAAAAAAAGG - Intronic
1089371040 11:117957838-117957860 CAGTGTGGCTGGAATAAAGCAGG - Intergenic
1089430971 11:118424200-118424222 CAGTGTGGCTGGAGGAAGAGTGG - Intronic
1089634358 11:119802949-119802971 CAGTGTGACTGGTGGAAAAGTGG + Intergenic
1089676337 11:120092537-120092559 CAGTGTGGCTGGTGCAGAGAGGG + Intergenic
1090410977 11:126509523-126509545 CAGAATGGCTGGGGAAAAAAAGG - Intronic
1090572491 11:128062643-128062665 CAGGGTGGCAGGAGCAAAGATGG + Intergenic
1091574647 12:1721878-1721900 CAGTGTGGCTGGAATGTAATGGG + Intronic
1093538255 12:20248385-20248407 CAGCTTGGCTGTAGTAGAAAAGG + Intergenic
1093666236 12:21816582-21816604 TAGTGTGGCCAGAGTAAAAGTGG + Intronic
1094206768 12:27848661-27848683 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
1095590310 12:43895960-43895982 CAGTGTGGCTAGAATAAAGCAGG - Intronic
1096874196 12:54614513-54614535 CAGTGGGGCTGGAGAAGAGAAGG + Intergenic
1097285622 12:57874942-57874964 CAGTGTGGCTGGAGCAATGTAGG + Intergenic
1097926951 12:65139324-65139346 CAGTGTGGCTAGAGAGAAATGGG - Intergenic
1098599545 12:72314566-72314588 CAGTGTCACTGAAGGAAAAATGG + Intronic
1098731801 12:74044770-74044792 CAGTGTGGATGTGGTGAAAAGGG + Intergenic
1098832369 12:75377652-75377674 CACTGTGGCTGGAATAAAGCAGG - Intronic
1098908862 12:76188950-76188972 CAGTGTAGCTGGAGAAAAGTAGG - Intergenic
1099265868 12:80447040-80447062 CAGTGTGGATGCAGAGAAAAGGG - Intronic
1099403260 12:82226190-82226212 CAATGTGGCTTGAATAAATAAGG - Intronic
1100543374 12:95578892-95578914 CACAGTGTCTGGAGTACAAAAGG + Intergenic
1100904515 12:99282300-99282322 CAGTGTGGCTGGAGCAAAGTGGG + Intronic
1101612647 12:106305055-106305077 CAGTTTGGCTGGAGAAAATTTGG - Intronic
1101623694 12:106417309-106417331 CAGTGTGGCTGGAGTGAGTGAGG + Intronic
1103242812 12:119429057-119429079 ACGTGTGTCTGGAGTAAAAAAGG - Intronic
1104497919 12:129257965-129257987 CAGAATGGCTTGAGCAAAAAAGG - Intronic
1104678090 12:130729367-130729389 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
1105665582 13:22552339-22552361 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1105844435 13:24282093-24282115 CAGTGTGGCTGAAGTGATGAGGG + Intronic
1107239340 13:38213131-38213153 CAGTGTGGCTACAATAAAACAGG + Intergenic
1108094826 13:46890662-46890684 CAGTGTGGCTGAGGAAAAGATGG + Intronic
1110533672 13:76626706-76626728 CAGTGTGGCTAGAGTACAGAGGG - Intergenic
1110832340 13:80045741-80045763 CAATGTGGCTGGAACAAAACAGG - Intergenic
1111503220 13:89152744-89152766 AATTGTGGCTGAAGTAGAAAGGG - Intergenic
1113218796 13:108074311-108074333 CAGTGTGGCTGGAACAAAGCAGG - Intergenic
1115403648 14:32992059-32992081 CAGTGAGCCTGGAGTCAGAATGG + Intronic
1115618319 14:35117546-35117568 CAGTGAGGCTGAAGTGGAAATGG - Intronic
1116709790 14:48353317-48353339 CAATGTAGCTGGAATACAAAGGG - Intergenic
1116823812 14:49651949-49651971 TAGTGTGGCTGGAGTAAATGGGG + Intronic
1117108884 14:52428017-52428039 CAATGTGGCTGGAGTCTAATGGG - Intergenic
1117672144 14:58119066-58119088 CAGAATGGCTGGAGAAGAAAAGG + Intronic
1117824366 14:59686863-59686885 GAATGTGCCTGGATTAAAAATGG - Intronic
1117934778 14:60890770-60890792 CAGTGTGGCTAGAATAAAGCAGG - Intronic
1118560644 14:67077786-67077808 CAGTCTGGTTGGATCAAAAAGGG - Intronic
1119068077 14:71550970-71550992 CAGTGTGGCTGGAGAGGAAAGGG - Intronic
1119068163 14:71551748-71551770 CAGTGTGGCTGGAGGGGAAAGGG - Intronic
1119257953 14:73215765-73215787 CAGAGTGGCTAGAATGAAAAAGG + Intronic
1119477239 14:74937930-74937952 CAGTGTGGCTGGAGCATGATGGG - Intergenic
1120100952 14:80445207-80445229 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
1120515763 14:85468452-85468474 CAGAGTGACTGGAGCAAAGAAGG + Intergenic
1120702151 14:87709990-87710012 TATTGTGGCTGAAGTAGAAAAGG - Intergenic
1120924776 14:89787085-89787107 CAGTGCGGCTGGAATAAAGCAGG + Intergenic
1122027694 14:98889464-98889486 CAGTGGGGCTGGAGTGTAGAGGG + Intergenic
1122201138 14:100123493-100123515 CAGTGTGGTTAGAGGAAGAAAGG - Intronic
1122385391 14:101341828-101341850 CAGTGTGGCTGCAGCAAAGGAGG - Intergenic
1125574587 15:40746544-40746566 CCCTGTGGCTGGAGCAAAACAGG + Intronic
1125889444 15:43254661-43254683 TGGTGTTGCTGGAGAAAAAATGG - Intronic
1126495744 15:49288871-49288893 CAGTGAGGATGGGATAAAAAGGG + Intronic
1127861452 15:62997508-62997530 AAGTGTGGCTGGAATGCAAAGGG + Intergenic
1128820365 15:70646869-70646891 CAGCTTGGCTGGAATAAAAAAGG + Intergenic
1128831304 15:70771881-70771903 CAGTGTGGCTGGAGCATAGTGGG + Intergenic
1129137131 15:73564455-73564477 CACAGTGACTGGAGCAAAAAAGG + Intronic
1129503687 15:76063410-76063432 CAGTGTGGATGGAGCAGAATAGG - Intronic
1131513048 15:93060163-93060185 CTCAGTGGCTGGAGTAGAAATGG - Intronic
1132357324 15:101181580-101181602 CAGTGGGGCTGGAGAGAGAAGGG - Intronic
1133092803 16:3417834-3417856 CACTCTGGCTGAAGTACAAATGG - Intronic
1133662501 16:7932968-7932990 CAGTGTGGCCAGAATAAAAGCGG - Intergenic
1133747977 16:8701907-8701929 CAGTGTGGCTGGAGCAGAGCAGG + Intronic
1133772938 16:8878248-8878270 CAATGTGGCTGGAGTAGGGAGGG + Intergenic
1133905874 16:10021764-10021786 CAGTGGGGCTGGAGCAAATGAGG + Intronic
1134349937 16:13427658-13427680 CAGTGTGGCTGGAGAGAGAGAGG + Intergenic
1135961924 16:27002132-27002154 CAGTGTGGCTGGAAGAGAATAGG + Intergenic
1137342696 16:47625468-47625490 CAGTGTGTCTGGAGCATAACAGG - Intronic
1137469151 16:48739179-48739201 CAGAGTAGCTGGAGAAACAAGGG - Intergenic
1138247928 16:55480672-55480694 CAGGGTGGCTGAAGCAACAAGGG - Intronic
1138900113 16:61258640-61258662 CAGTATGTGTGGAATAAAAAAGG - Intergenic
1139910711 16:70395671-70395693 CAGAATGGCTGGAATAAAACTGG + Intronic
1140237958 16:73175464-73175486 TAGTGTGGCTGGAACATAAAAGG - Intergenic
1140681271 16:77387246-77387268 CAGTGTGGCAGGAAGAAAAGTGG + Intronic
1141993316 16:87622363-87622385 GAGAGTGGCTGGAGTGAGAACGG + Intronic
1143363594 17:6390796-6390818 CACTGAGGCTGGAGTACAAGTGG - Intergenic
1143370718 17:6437301-6437323 CCGTGTGGCTGGAGAAAGGATGG - Intergenic
1143686172 17:8517823-8517845 CAGTGTGGCTGGAGCAGGATGGG - Intronic
1144539858 17:16130385-16130407 CAGGGTGGCTGGAGCAAAAGAGG + Intronic
1144743575 17:17598171-17598193 CAGTGTGGCTGGAGTACAGAGGG - Intergenic
1144808602 17:17984204-17984226 CAGTCTGGATGGGGTACAAAGGG + Intronic
1144995584 17:19265897-19265919 CAGTGTGGGTGGGGTAGAAGGGG - Intronic
1145275169 17:21424832-21424854 CTCTGTGGCTGGAGGAGAAAGGG + Intergenic
1145313023 17:21710730-21710752 CTCTGTGGCTGGAGGAGAAAGGG + Intergenic
1145838088 17:27969993-27970015 CAGTGAAGCTGGAGAAAAGAGGG - Intergenic
1147434611 17:40401853-40401875 CAGTGTGGCTGGAGAGGAGATGG + Intronic
1148798276 17:50207963-50207985 CAGTGTGGCTGGAGCACCACAGG + Intergenic
1150179645 17:63103335-63103357 CAGTCTGGAGGGAGTAAGAATGG + Intronic
1150703462 17:67467466-67467488 CAGAGTGACTGGAGTATTAATGG + Intronic
1151431978 17:74069912-74069934 CTGTGGGGCTGGTGTAAAGAAGG - Intergenic
1153101161 18:1471244-1471266 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
1153118468 18:1690376-1690398 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
1153181206 18:2435802-2435824 CACTGTGGCTGGAGCAAGATGGG - Intergenic
1153758637 18:8308834-8308856 AAATGTGGCTGGAGTAACAAAGG - Intronic
1155257719 18:24013992-24014014 CAGTGGGGCAGGAGGAGAAATGG - Intronic
1155361662 18:25009334-25009356 TAGTGTGGATGCAGTGAAAAGGG + Intergenic
1155367789 18:25066153-25066175 CTGTTGGGCTGGAGCAAAAAAGG - Intronic
1155637532 18:27973597-27973619 CATTGTGGGTGAGGTAAAAAGGG + Intronic
1155775993 18:29762356-29762378 CAATGTGGCTGGAGTGAACTGGG - Intergenic
1156169861 18:34469613-34469635 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
1156692789 18:39728616-39728638 CAGAGTGGCTGTAGAAAAACTGG + Intergenic
1156894482 18:42229797-42229819 CAATGTGGCAGCATTAAAAATGG - Intergenic
1157412027 18:47471093-47471115 CAGTGTGACTCCAGTAAATAGGG + Intergenic
1157574792 18:48736383-48736405 CAGTGCAGCTGGAGGAAGAAGGG - Intronic
1157690687 18:49679450-49679472 CAGTGAGGCTGGAATAAAAGGGG + Intergenic
1157966782 18:52217449-52217471 AAGAGAGGGTGGAGTAAAAAGGG + Intergenic
1158117824 18:54016312-54016334 CAATGTGGCTGGAGTTCACAGGG - Intergenic
1159310633 18:66703051-66703073 CAGTGGGGCGGGAGTCAAATAGG - Intergenic
1159904365 18:74076827-74076849 CAGTGTGGCTGGAGCACAGATGG - Intronic
1160579472 18:79875400-79875422 CAGTGAAGCTGGAGTGGAAATGG - Intronic
1161579528 19:5073192-5073214 AAGTGTGGCTGGCTGAAAAATGG - Intronic
1161638813 19:5406803-5406825 CAGTGTGGCTGGAGCAGAATGGG - Intergenic
1161649419 19:5475118-5475140 CAGTGTGGCTGGAGTGAGCTGGG + Intergenic
1162157889 19:8692119-8692141 CAGTGTGGCTGGAGGTAAAGGGG + Intergenic
1162487634 19:10971232-10971254 CAGTGTGGCTGGAGCAGGGAAGG - Intronic
1163344808 19:16733888-16733910 CAATGTGACTGGAGGAAGAAAGG - Intronic
1163423864 19:17230152-17230174 CAGTTTGACTGGAGTAGACATGG + Intergenic
1163682329 19:18690269-18690291 CTGTGAAGCTGGAGTAAAACGGG + Intronic
1163920832 19:20287021-20287043 CAGTGTGTCAGAAGTATAAATGG + Intergenic
1164296667 19:23916175-23916197 CAGTCAGGCTGGAGGAATAAGGG - Intronic
1164695640 19:30241594-30241616 CAGTGTGGCTGGAGTAAAAAAGG + Intronic
1166039471 19:40192805-40192827 CACTGTGCCTGGAGTGAGAAGGG + Intronic
1166215664 19:41333056-41333078 CAGTGTGGCTGGAGTGGAGTAGG - Intronic
1166268138 19:41697353-41697375 CAGAGTGGCTGGAGCAGAGAGGG - Intronic
1167851340 19:52204732-52204754 CAGTGTAGCTGGAGTCACATTGG + Intronic
925847562 2:8047516-8047538 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
926785890 2:16518135-16518157 CTGTGTGGCTGGAATAAGATGGG - Intergenic
927028578 2:19096386-19096408 CAGTGCGGCTAGAGTAAAGCAGG + Intergenic
927355660 2:22170184-22170206 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
927932500 2:27054069-27054091 CTGTGTGGCAGGAGTAAGAATGG - Intronic
928549105 2:32354595-32354617 CTGTGGGGCTGGAGTGAGAAGGG - Intergenic
928608733 2:32969905-32969927 CAGTGAAGCTGCAGAAAAAAAGG - Intronic
929020691 2:37549683-37549705 CAGGGTGGCTGAAGGAAACATGG - Intergenic
930480857 2:51946737-51946759 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
930633960 2:53785013-53785035 CAGTGTGGCTGGAGTGTAAGAGG - Intronic
931110122 2:59101269-59101291 CAGTGTGGCTAGAGTAAAACAGG - Intergenic
931731964 2:65161110-65161132 TAGAGTGGCAGGGGTAAAAAAGG + Intergenic
932076849 2:68672301-68672323 TAGTGTGGCTGGAGTAAGGAGGG + Intergenic
932561491 2:72875178-72875200 CAGTGTGGCTGGAATAAAGCAGG - Intergenic
932858075 2:75259820-75259842 CAGTCTCCCTGGAGTAACAATGG + Intergenic
932904992 2:75739448-75739470 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
933008767 2:77029541-77029563 CAGTGTGGCTAGAATAAAGCAGG - Intronic
934729540 2:96647913-96647935 CAGGGTGGCTGGAGGAATGAGGG + Intergenic
934954455 2:98605934-98605956 CAGTGGGGCTGGAGGAAAGCAGG - Intronic
936938715 2:117861101-117861123 CAGACTGGCTGGAGAAAGAAGGG + Intergenic
937239711 2:120452219-120452241 CAGTGGGGATGGAGTGAAAGTGG - Intergenic
937348548 2:121143707-121143729 CAGTGAGGCTGGAGCAGAGAGGG + Intergenic
937732634 2:125252891-125252913 CAGTGTGGCTGCAATAAAGCAGG - Intergenic
938769425 2:134488343-134488365 CAGTGTGGCTAGAATAAAGCAGG + Intronic
938902709 2:135811563-135811585 CAGTGTGGCTGGAGCAATGAGGG + Intronic
938997198 2:136692700-136692722 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
941052118 2:160746840-160746862 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
941122624 2:161548183-161548205 ATTTGTGGCTGAAGTAAAAATGG - Intronic
941450072 2:165650236-165650258 GAATGTGCCTGGAATAAAAAAGG + Intronic
941790003 2:169541860-169541882 CAGTGTGGCAGGAGTAGATGAGG - Intronic
942212625 2:173686653-173686675 CAGTGTGATTGGAGGACAAAGGG - Intergenic
943565768 2:189514362-189514384 CACTGTGGCTGGGGTGAGAAGGG - Intergenic
943749120 2:191493680-191493702 CTGAGTGGCTGGAGATAAAATGG + Intergenic
944091896 2:195921069-195921091 CAGTGTGGATGTAGTGAAAGGGG + Intronic
944189212 2:196983367-196983389 CAGTGTGGCTGGAGACTCAAGGG - Intronic
945420834 2:209634048-209634070 CGGTGTGGCTGGAGCAAAGATGG - Intronic
945712483 2:213316162-213316184 CAGAGTGGCTGGAGTAATCAAGG - Intronic
945923439 2:215779550-215779572 AAGTCTGGCTGGATTAGAAAGGG - Intergenic
946157837 2:217818500-217818522 CAGTGTGGCTGGCGTCCACACGG - Exonic
946187654 2:217990234-217990256 GAGTGTGGCTGGTGTATAGATGG - Intronic
948280068 2:236740297-236740319 CAGTGTGGCTGGAGAGAAGTGGG + Intergenic
948512265 2:238476488-238476510 CAGTGAGGCTGGAGTGCAGAGGG + Intergenic
1169005526 20:2204144-2204166 CAGTGTGGCTGGAATGAAGTGGG - Intergenic
1169174975 20:3502979-3503001 CAGTATCACTGGAGTGAAAAAGG - Intronic
1169975141 20:11316801-11316823 CAGTGTGACAGGAATAGAAAGGG + Intergenic
1170590281 20:17766137-17766159 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1172037680 20:32021229-32021251 CATGGTGGCTGGAGTACAAATGG - Intronic
1172282268 20:33716313-33716335 CAGTGTGGCTGGAGCAGCAGAGG - Intronic
1173008094 20:39156597-39156619 CAGAGTGGCTGGAGTTGAACAGG + Intergenic
1173229168 20:41180798-41180820 CAGAGTGGCTGGAGGAAAAGTGG - Exonic
1174124021 20:48289498-48289520 TAGTGTGGCTGGTGGAATAATGG + Intergenic
1174299260 20:49569570-49569592 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
1174308524 20:49632236-49632258 CAGCGTGGCTGGAGTAGAGGGGG - Intergenic
1174392297 20:50225194-50225216 CCATGTGGCTGGAGTAGAATGGG + Intergenic
1174727249 20:52876078-52876100 CAGTGTGGTTGGAGTAGGGATGG + Intergenic
1176419988 21:6506351-6506373 CAGTGTGGCTGGAACAAAGCAGG + Intergenic
1176969901 21:15253263-15253285 CAGAGTGGCTGAAATAAAAGTGG - Intergenic
1177378232 21:20302107-20302129 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
1178683737 21:34695229-34695251 AAATATGGCTGGAGTAAAGACGG - Intronic
1179039385 21:37788612-37788634 GAGTGTGGCAGAAGTGAAAAAGG + Intronic
1179437957 21:41374984-41375006 CAGTGTGACTGGTGAAAAAGAGG - Intronic
1179695479 21:43114671-43114693 CAGTGTGGCTGGAACAAAGCAGG + Intergenic
1179995983 21:44974483-44974505 CAAAGTGTCTAGAGTAAAAATGG - Intronic
1180847784 22:18993813-18993835 CAGTGAGGCAGGAGTCATAATGG + Intergenic
1180860075 22:19073628-19073650 CACTGGTGTTGGAGTAAAAATGG + Intronic
1181171188 22:21011220-21011242 CCGTGTGGCTGGAGTGGAAGAGG + Intronic
1181178157 22:21049299-21049321 CCGTGTGGCTGGAGTGGAAGAGG - Intronic
1181861421 22:25822135-25822157 CAGTGTGGCTGGAATGTAACGGG - Intronic
1181908309 22:26217360-26217382 CAGTGTGGCCGAAAGAAAAAAGG - Intronic
1182219814 22:28749245-28749267 CATTGTGGCTGGAGTGGAGAAGG - Intronic
949573575 3:5317290-5317312 CACTCTGGCTTGAGTGAAAAAGG + Intergenic
949669361 3:6380676-6380698 CAGGCTGGCTGGAGCAGAAATGG + Intergenic
950139890 3:10608196-10608218 CAGTGTGGATGGAGTGAGGAGGG - Intronic
950487996 3:13284138-13284160 CAGTGAAGCTGGTGTAACAAAGG - Intergenic
950608132 3:14102871-14102893 CAGTGAGGCTGCAGAGAAAATGG + Intergenic
950713532 3:14831182-14831204 CAGTGTGGGTGGAGTGCAGAAGG + Intronic
950988273 3:17400722-17400744 CAGTGTGGCTAGAATAAAGCAGG + Intronic
952492922 3:33888989-33889011 AAGTGTTGCTGTAGTGAAAAGGG - Intergenic
952684633 3:36133853-36133875 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
953399761 3:42602465-42602487 CAGTGTGGCTGGAGTAGAAGAGG + Intronic
954343650 3:49977202-49977224 CAGTGTGGCTACAGCAAAATAGG - Intronic
954681270 3:52347313-52347335 CAGTGTGGCTGGAGTCAGGGAGG + Intronic
954803966 3:53204526-53204548 CAGTCAAGATGGAGTAAAAAGGG + Intergenic
955169154 3:56546287-56546309 CAGTGGGGAAGGAGTAAACAAGG + Intergenic
955736090 3:62039832-62039854 CTCTGTGGCTGGGGGAAAAAAGG - Intronic
956256673 3:67290599-67290621 CAGTGTGGCTGCAGAGGAAAGGG - Intergenic
956410583 3:68974275-68974297 CAGTGTGGCTGGTGTGATCAAGG - Intergenic
957026654 3:75190067-75190089 CAGTTTGACTGGAGGAATAAGGG + Intergenic
957842957 3:85694676-85694698 GAGTGTGTCTGGAGTATAGATGG - Intronic
958693971 3:97504584-97504606 CAGTGTGGCTTGGCTAAAGAAGG - Intronic
960444896 3:117735855-117735877 CAGTGTGACTGGACTAGAATGGG - Intergenic
960461748 3:117943977-117943999 CAGTGGGGTTGGAGGATAAAAGG + Intergenic
960705250 3:120475257-120475279 TAGTCTGGCTGGAGTAGACAAGG + Intergenic
961710656 3:128825479-128825501 CAGTGTGGCTAGAACAAAACAGG - Intergenic
962449493 3:135500792-135500814 CAGTGTGGCTAGAGTACAGCAGG + Intergenic
963792913 3:149602617-149602639 CAGTGTGGCCAGTGTAAACAAGG - Intronic
964298969 3:155266633-155266655 CGGTGTGGATGTGGTAAAAAAGG + Intergenic
964342283 3:155720352-155720374 CAGTGTGGATGTGGTGAAAAGGG - Intronic
964612829 3:158632099-158632121 CAATGTGGCTGGAGCAAAAGGGG + Intergenic
965707379 3:171522631-171522653 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
966007339 3:175031751-175031773 CAGTGAGGCTGGAGAGAAAAAGG - Intronic
966160017 3:176957848-176957870 CAATGTGGCTGGCATAATAAGGG - Intergenic
966386170 3:179401038-179401060 AAGTGGGGGTGGAGGAAAAAAGG - Exonic
966726082 3:183109888-183109910 CAGTGAGGCTGTAGAGAAAAGGG - Intronic
967745215 3:193047479-193047501 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
967815663 3:193796168-193796190 CAGCGTGGCTGGAGTAAAGAGGG - Intergenic
969982566 4:11173225-11173247 CAGTGTGGCTGGAATAAAGCAGG + Intergenic
970159103 4:13171332-13171354 CAGTGTGGCTGGTGCAGAGAGGG - Intergenic
970213091 4:13731244-13731266 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
970752339 4:19379121-19379143 CATTGCTGCTGGAGTATAAAGGG - Intergenic
970841218 4:20471945-20471967 AATTGTGGCTGGAGAAAATAAGG - Intronic
971126759 4:23762883-23762905 CAGTGTGGCTAGAATAAAGCAGG + Intronic
972763205 4:42127471-42127493 CACTGTGGCATCAGTAAAAAGGG - Intronic
972906405 4:43753091-43753113 CAATGTGACTTGAGTAAGAAAGG - Intergenic
973168075 4:47102669-47102691 CAATGTGGCTGGAACATAAAGGG + Intronic
973297299 4:48538873-48538895 CATTGAGTCTGGAGGAAAAAAGG - Intronic
973666600 4:53165571-53165593 CAGTGTGGCTGGAGCAAACAAGG - Intronic
974290896 4:59928819-59928841 CAGTGTGGCAGCAGTACCAAAGG + Intergenic
974563912 4:63558632-63558654 TAGTGAGGCTGCAGAAAAAAAGG + Intergenic
974578540 4:63762422-63762444 CAGTGTGGATAAAGGAAAAAGGG + Intergenic
975547137 4:75571347-75571369 CAGTGTGTCTGGAGTGGGAAAGG - Intergenic
975845193 4:78517698-78517720 CAGTGTGCCTGGTGTAGAATAGG + Intronic
975906311 4:79216828-79216850 CAGTATTGATGGAATAAAAATGG + Intergenic
977155669 4:93569707-93569729 CAGTGCGGCTGAAGGAAAATGGG - Intronic
977423857 4:96839985-96840007 CAGAGTGGCTGGAAAAAACAAGG - Intergenic
977449055 4:97171218-97171240 CAGTGTGGCTAGAATAAAGTAGG - Intergenic
978457070 4:108906216-108906238 CAGTGTGGCTGGAGTATGTGAGG - Intronic
979034083 4:115690118-115690140 CAATGTGCCTTTAGTAAAAAGGG + Intergenic
980765577 4:137299668-137299690 CAGTGTGGCAGAAAAAAAAAGGG - Intergenic
981144124 4:141305089-141305111 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
981619137 4:146673885-146673907 CAGTGTGGCTAGAATAAAGCAGG + Intergenic
981622991 4:146724982-146725004 CAGTGTAACTGGAGTATATATGG + Intronic
982538496 4:156637911-156637933 GAATGTGGCTGGAGGAACAAGGG - Intronic
984747639 4:183238550-183238572 CACTGTGGCTGGATTACAGAGGG - Intronic
984855004 4:184187449-184187471 CAGTGTAGCAAGAGCAAAAAAGG - Intronic
986302791 5:6491436-6491458 AGTTCTGGCTGGAGTAAAAACGG - Exonic
986738093 5:10682372-10682394 CAGTGTCGCTGGAGGAAGCATGG + Intronic
987676779 5:21084717-21084739 CAGAGTGGCTAGAATAAAACAGG + Intergenic
990399455 5:55423464-55423486 CAGTGTGGCTGGAGCAGAATGGG + Intronic
990850285 5:60195222-60195244 CATTATGGAGGGAGTAAAAAGGG - Intronic
991446198 5:66702677-66702699 GAGTGTGGCTGGAGCAGAACAGG + Intronic
991682745 5:69154752-69154774 CAGTGTGGCTAGAGTATAGAGGG - Intergenic
992082666 5:73249754-73249776 CAGCGTGGCTGGAGTTACACAGG - Intergenic
992538789 5:77740763-77740785 GAGTGCTGATGGAGTAAAAAAGG + Intronic
992712335 5:79471779-79471801 CACTGTGGCTGGAACAAAAGAGG - Intronic
993036410 5:82762348-82762370 CAGCATGGCTGGACTAAAACAGG + Intergenic
993087837 5:83385769-83385791 CAGTGAGGATGGAGAAAAATTGG + Intergenic
993092304 5:83441409-83441431 CTGGGTGGCTGGAGTCAAGATGG - Intergenic
993127819 5:83857325-83857347 CAGTGATGCTGAAGTGAAAATGG - Intergenic
993706473 5:91177455-91177477 CAGGGTGGCTGGAGTGGTAAGGG - Intergenic
994151935 5:96457527-96457549 CAGGGTGGCTGGAGCAACATAGG - Intergenic
994237252 5:97377237-97377259 CAGTGAGGCAGGAAAAAAAAAGG - Intergenic
995183095 5:109247039-109247061 CAGTGGGGATGGAGTAAACTGGG + Intergenic
995696849 5:114888356-114888378 CAGTGAGGCTGTAGAAAAAAAGG + Intergenic
996036051 5:118759914-118759936 CAGTGTGGCTAGAGTAAAGCAGG - Intergenic
996295344 5:121908297-121908319 TAGTGTGGCTGTAGTGAAAGTGG + Intergenic
996556905 5:124787671-124787693 CAGTCTGGCTTAAGCAAAAAAGG + Intergenic
996940489 5:128999645-128999667 CAGATAGGCTGGAGTAAACAAGG - Intronic
997090467 5:130850526-130850548 CAGTGTGCCTGTAGCAAAATTGG + Intergenic
997608449 5:135193209-135193231 CAGAGTGGCTGGAAATAAAAGGG - Intronic
998320108 5:141221939-141221961 CAGTGTGGATGGAGAGAAGAGGG - Intergenic
998667927 5:144319769-144319791 CTGTGTTGCTTGAGTAAAAATGG + Intronic
998880248 5:146638148-146638170 TAGTGTGTCTGGTGTAGAAAGGG + Intronic
999175590 5:149629599-149629621 CAGTGTGGCCGGAGAAGAAAGGG + Intronic
999418972 5:151424327-151424349 CAGTGATGCTGGAGGAAGAAAGG + Intergenic
999538883 5:152549977-152549999 CAGTGTGGCTGGAGTAAAATGGG - Intergenic
999940141 5:156533245-156533267 CAGTTTGAGTGGAGAAAAAATGG - Intronic
1000037001 5:157456504-157456526 CATTGTGGCTAGAGGAGAAAAGG + Intronic
1000669866 5:164047617-164047639 CAGTGTGACAAGAGTAATAATGG - Intergenic
1001966515 5:175913672-175913694 CAGTGTGGCTGCAGCAAGTAGGG + Intergenic
1003899913 6:10644840-10644862 CAGGATGGCTGGAGTAACAAGGG - Intergenic
1004291450 6:14371042-14371064 CAGTGTGACTGGTGAAAATAGGG + Intergenic
1004428308 6:15521597-15521619 CAGTATGTGTGGAATAAAAAAGG + Exonic
1004817633 6:19329880-19329902 CAGTGTGGCTGAAGTAGAGTGGG + Intergenic
1005170003 6:22972858-22972880 TAGTGCAGCTGAAGTAAAAAGGG - Intergenic
1005587330 6:27289337-27289359 CAGTGTGGTTGGAGAGAAAGGGG - Intronic
1005909355 6:30294532-30294554 CAGTGTGTCTGGAGTACATGGGG + Intergenic
1006616021 6:35327484-35327506 AAGTGGGGCTGGAGTACAAGAGG + Intergenic
1008198338 6:48553937-48553959 CAGCATGGCTGGAATAAAGAAGG - Intergenic
1008559410 6:52709097-52709119 TAGTGTGTCTTCAGTAAAAATGG + Intergenic
1009675531 6:66814871-66814893 CAATGTGGTTCGAGTACAAAAGG - Intergenic
1010065018 6:71672500-71672522 CAGTGTGGCAAAAGAAAAAAAGG - Intergenic
1010629355 6:78178934-78178956 CAGTGAGGCTGCAGAGAAAAGGG + Intergenic
1010831771 6:80540164-80540186 CAGAGTGGCTAGAATAAAACAGG - Intergenic
1010977043 6:82327034-82327056 CAATGTGGGTGCAGTGAAAAGGG - Intergenic
1012036417 6:94146737-94146759 CAGAGTGGCATGAGTAAAAATGG - Intergenic
1012355582 6:98310045-98310067 CAGTGTGTCTGGAGCAAAAGGGG - Intergenic
1012664365 6:101948761-101948783 CACTGTGCCTGGCCTAAAAAGGG + Intronic
1013469577 6:110449925-110449947 CAGTGTGGCAGAAGTAGAGAAGG - Intronic
1013473349 6:110485730-110485752 CAGTGTGGCTGGAGTGGAGCAGG - Intergenic
1015092620 6:129376590-129376612 CAGTATGGCTGGAGTGCAGATGG - Intronic
1015154554 6:130077688-130077710 CAGTGTGGCTGGAGTTTCCAGGG - Intronic
1015314199 6:131798551-131798573 CAGTTTTTCAGGAGTAAAAATGG - Intergenic
1015746555 6:136516090-136516112 CAATTTGCCTGGAGTAAGAAAGG + Intronic
1016151169 6:140744938-140744960 CAGTGTGGCTAGAATAAAGCTGG - Intergenic
1016355362 6:143212367-143212389 CAGGGAGGCTGGGGTAAAGAAGG - Intronic
1016912659 6:149214570-149214592 CAGTGTGACTGGAGCACAGAGGG - Intergenic
1017602562 6:156099756-156099778 CAGGGTGGCAGGAGAGAAAAGGG - Intergenic
1017801740 6:157902492-157902514 CAGTTTGCCTGCAGTAAAACAGG - Intronic
1017913087 6:158811916-158811938 CAGTGTGGAAGGAATAAAAGAGG + Intronic
1018940959 6:168308633-168308655 CAGGGTGGCTGGAGTACAGACGG - Exonic
1019598822 7:1871280-1871302 CAGTGTGGCAGGTGTTACAATGG - Intronic
1019744659 7:2692870-2692892 CAGTGTGGCTGGAACAAATTGGG - Intronic
1021108346 7:16665577-16665599 CAGTGAGGCTGGGGGAAACAGGG - Intronic
1022201658 7:28123106-28123128 CAGTGTGGCTAGAGGAGAGAGGG - Intronic
1022574294 7:31482664-31482686 CGGAGTGGCTGGAGGAAGAAAGG + Intergenic
1023088769 7:36598489-36598511 CAGTTTTGCTGAAGTAAATAAGG - Intronic
1023835094 7:44063207-44063229 CAGTCTGGCTGGAGTCACACTGG - Intronic
1023942541 7:44779142-44779164 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
1024610798 7:51062561-51062583 CAGTGTGGCTGGTCTTAAACTGG - Intronic
1025088725 7:56044788-56044810 CAGTGAGACTGGAAAAAAAAAGG + Intronic
1025675912 7:63642428-63642450 CACTGCGCCTGGCGTAAAAAAGG - Intergenic
1026113437 7:67476644-67476666 CACTCTGGCTGGGGTAATAAGGG - Intergenic
1026470728 7:70692926-70692948 GAGTGTGGCTGGAGGAAGAGAGG - Intronic
1026530363 7:71192190-71192212 CAGTGTGGCTAGAATGAAACAGG - Intronic
1026814692 7:73501379-73501401 CAGTGTGGTTGGACTACAGAAGG - Intronic
1027163246 7:75817337-75817359 GAGTGAGGCTGGGGTAAATAGGG + Intronic
1027678948 7:81194966-81194988 CAGTGTGGCTAGAACAAAACGGG + Intronic
1027807859 7:82852392-82852414 CAGTGTGGCTAGAATAAAGCAGG + Intronic
1028504909 7:91560199-91560221 CATTGTAGCTGGAGAAATAAGGG - Intergenic
1029482800 7:100823366-100823388 CAGTGTGGCTGGAGCACAGTGGG + Intronic
1029574664 7:101395558-101395580 CAGCGGGGCTGGAGGGAAAATGG + Intronic
1029685651 7:102146004-102146026 GAGTGTGGCTGGTGGAAAATGGG - Intronic
1029796098 7:102896082-102896104 CAGAGTGGCTGGAGTAGAGTTGG + Intronic
1029905864 7:104093021-104093043 CAGTGGGGCTGGAGGAGACAAGG + Intergenic
1029944161 7:104514121-104514143 CTCTGTGGCTGGAGAAAACATGG - Intronic
1030316780 7:108123975-108123997 CAGTGGGTCTGGAGAAAAGAAGG + Intronic
1031185487 7:118474630-118474652 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
1032254192 7:130284123-130284145 CAGTGTGGATGGAGTGATGAGGG + Intronic
1033985365 7:147219538-147219560 CAGTGTGGCTAGAATAAAGCAGG - Intronic
1034083051 7:148298471-148298493 CAGTGTGGCTAGAATAAAGCAGG - Intronic
1035974223 8:4288944-4288966 TAGTGTGGCAGCTGTAAAAATGG + Intronic
1037162867 8:15793937-15793959 CAGTGTGGCTAGAGCAAAGTGGG + Intergenic
1037353549 8:17992381-17992403 TAGTGTGGATGTGGTAAAAAGGG - Intronic
1037414414 8:18633897-18633919 CAGTGGGGCTGCAGAGAAAAGGG - Intronic
1037620348 8:20558160-20558182 CAGTGTGGCTGGAGCACAGAAGG - Intergenic
1039813187 8:41068308-41068330 GAAAGTGGCTGGAGAAAAAAAGG + Intergenic
1040626332 8:49153481-49153503 TAGTGTGGATGTAGTGAAAAGGG - Intergenic
1041020573 8:53634020-53634042 AAGTGTGGATGGAGCAAAAGAGG - Intergenic
1041853067 8:62416094-62416116 CAGTGAGGGTGCAGAAAAAAGGG - Intronic
1041950604 8:63496719-63496741 CAGCGTGGCTAGAATAAAACAGG - Intergenic
1042339202 8:67661311-67661333 CATTGTGGCTGGAGTAGAGTAGG + Intronic
1042396178 8:68293779-68293801 AAGGGTGGCTGGAAGAAAAAGGG - Intergenic
1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG + Intronic
1043509164 8:80932625-80932647 CAGTGTAGCTAGAATAAAACAGG + Intergenic
1043614023 8:82103355-82103377 CAGTGTGGCTAGAATAAAGTGGG + Intergenic
1044429063 8:92087327-92087349 TACTGTGGCTGCAGCAAAAAGGG - Intronic
1045032189 8:98147686-98147708 CAGTGTGGCTAGAGTGGAGAGGG + Intronic
1046356355 8:113090608-113090630 CAGTGTGGATGGGGAAGAAAGGG - Intronic
1046832056 8:118757268-118757290 CAGAGTTGATGGAGTAGAAATGG + Intergenic
1046970977 8:120223112-120223134 CAGTGTGGCTGGAACCCAAAAGG + Intronic
1047096984 8:121636440-121636462 CAGTGGGACTGGAGAGAAAAAGG - Intronic
1047285352 8:123483165-123483187 CAGTGTTGCTGGAATCAAAGTGG + Intergenic
1048106130 8:131411911-131411933 CAGTTTTGCTGGAGAAAGAAAGG + Intergenic
1048321149 8:133401128-133401150 CAGTTTCCCTGGAGGAAAAATGG - Intergenic
1048343674 8:133560052-133560074 CAGGGTGGCTATAGTAAACAAGG + Intronic
1048613382 8:136048422-136048444 GAGTATAGCTGGAGCAAAAAGGG - Intergenic
1050506329 9:6353017-6353039 CAGGGTAGCTGGAGTCAGAAAGG + Intergenic
1051368167 9:16335880-16335902 CAGTGTGGCAGGAGTCAGGAAGG + Intergenic
1051376765 9:16410077-16410099 CAATGGGTCTGGAGTAAGAAAGG + Exonic
1051589791 9:18766062-18766084 AAGTCTGGCTGGAGTACACAGGG + Intronic
1053813303 9:41877464-41877486 AAGTGGGACTGGATTAAAAAGGG + Intergenic
1054617292 9:67309975-67309997 AAGTGGGACTGGATTAAAAAGGG - Intergenic
1055774076 9:79749102-79749124 CAGTGGGGCTGGAATTAACAAGG + Intergenic
1056408264 9:86297966-86297988 CAGTGTGGCAGGAGTGGAACAGG - Intronic
1057018800 9:91679764-91679786 CTGTGTGGGTGGATTAAAATTGG - Intronic
1057834788 9:98435650-98435672 CAGTGTGGCTGGAATAAAGTGGG - Intronic
1058069906 9:100591387-100591409 CAGTGTGGCTGAGGAACAAAGGG + Intergenic
1058200951 9:102039932-102039954 CAGTGATGCTAAAGTAAAAACGG - Intergenic
1058578766 9:106431927-106431949 CACTGTTGCTGGAGTGTAAACGG - Intergenic
1058906496 9:109486431-109486453 CAGTTTGGGTGGAGTGGAAAAGG + Intronic
1059120181 9:111634570-111634592 CAGTGGCTCTGGAATAAAAACGG + Intronic
1059760696 9:117334610-117334632 CACTGTGGCTGGTGTGTAAAAGG - Intronic
1059877407 9:118650359-118650381 CTGTGTGGCTGGAGTATAATGGG + Intergenic
1060235466 9:121859701-121859723 CAGATGGGCTGGAGCAAAAAGGG - Intronic
1060536715 9:124395561-124395583 CAGTGTGGCTGCATGAAAACTGG - Intronic
1061006644 9:127931813-127931835 CAGAGTGGCTGGAGTGAAGAGGG + Intergenic
1061393203 9:130329154-130329176 CAGTGGGGCTGGAGCAGAAATGG - Intronic
1061789490 9:133051616-133051638 CAGTGTGGCCGGAGTGTAGAGGG - Intronic
1187619448 X:21034424-21034446 CAGTGTGGCTGAAGTCCAGAAGG + Intergenic
1187927617 X:24264327-24264349 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
1188012589 X:25073592-25073614 CAGTGTGGCTAGAATAAAGCAGG - Intergenic
1189512559 X:41677672-41677694 CAGTCTTACTGTAGTAAAAATGG + Intronic
1189699730 X:43705928-43705950 CAGGATGGCTGTAATAAAAAAGG + Intronic
1193307546 X:79967103-79967125 TGGTGTGGATGGAGTGAAAAGGG - Intergenic
1194429401 X:93782421-93782443 CAGTGTGACTGGAGCATAAAGGG + Intergenic
1194895630 X:99435893-99435915 CAGAGCGGCTGGAGTAAAACAGG + Intergenic
1195382942 X:104288283-104288305 CACTGTGTCTGGAAGAAAAATGG + Intergenic
1195405233 X:104505457-104505479 CACTGAGGCTGGAGTGAAATGGG + Intergenic
1195792895 X:108608156-108608178 CATTGTGGGTGGAGTGTAAATGG - Intronic
1196492157 X:116280710-116280732 CAGTTTGGCTGAAGTGAAAATGG + Intergenic
1196642628 X:118080618-118080640 CAGTGAGGCTGCAGAGAAAAGGG + Intronic
1196683613 X:118493313-118493335 CAGTGTGGCTGGAGCGTAGAAGG - Intergenic
1197371624 X:125633810-125633832 CGGTGTGGATGTGGTAAAAAGGG + Intergenic
1198575298 X:138004175-138004197 CAGTGTGGCTGGAGCATAGAGGG + Intergenic
1199022840 X:142902631-142902653 CAGTGTGGCTAGAATAAATCAGG - Intergenic
1199082660 X:143593906-143593928 CAGTGTGGCTAGAATATAAATGG - Intergenic
1199160155 X:144599768-144599790 CTGTGGGGCTAGAGTAAAACAGG - Intergenic
1199593395 X:149488388-149488410 CAGTGTGGCGGGAATCTAAAAGG + Intronic
1199598624 X:149527043-149527065 CAGTGTGGCGGGAATCTAAAAGG - Intronic