ID: 1164695724

View in Genome Browser
Species Human (GRCh38)
Location 19:30242063-30242085
Sequence GAGGGGTAATTCCTGTGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 156}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164695715_1164695724 1 Left 1164695715 19:30242039-30242061 CCCTCTCTGCTGTGAGCGCCTGT 0: 1
1: 0
2: 1
3: 17
4: 252
Right 1164695724 19:30242063-30242085 GAGGGGTAATTCCTGTGGGAGGG 0: 1
1: 0
2: 2
3: 11
4: 156
1164695716_1164695724 0 Left 1164695716 19:30242040-30242062 CCTCTCTGCTGTGAGCGCCTGTT 0: 1
1: 0
2: 0
3: 15
4: 166
Right 1164695724 19:30242063-30242085 GAGGGGTAATTCCTGTGGGAGGG 0: 1
1: 0
2: 2
3: 11
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164695724 Original CRISPR GAGGGGTAATTCCTGTGGGA GGG Intronic
900708689 1:4097094-4097116 GAGGGGACTGTCCTGTGGGATGG - Intergenic
903448225 1:23436091-23436113 GAGCTGTATCTCCTGTGGGAGGG - Intronic
903776561 1:25797794-25797816 GAGGGGTAAGTGCTCTGAGAGGG - Intergenic
904865419 1:33575111-33575133 GAGGGACACTTCCTGTGGGTAGG + Intronic
904962093 1:34341371-34341393 GAAGGGGAATTGCTGTGTGAAGG - Intergenic
908232290 1:62117663-62117685 TGGGGGTTTTTCCTGTGGGAGGG + Intronic
908514258 1:64875991-64876013 GAGGGGTAAATGCTGTTTGATGG + Intronic
908539161 1:65106245-65106267 GCAGGCTGATTCCTGTGGGATGG + Intergenic
910736566 1:90464821-90464843 GAGGGGAAATTACTGGGGTAAGG - Intergenic
912865201 1:113250340-113250362 GACAGGAAATTCATGTGGGAAGG + Intergenic
913030903 1:114901977-114901999 GAAGCATAATTGCTGTGGGATGG + Intronic
915203236 1:154249559-154249581 TAGGGGAAATACATGTGGGAAGG - Intronic
915313338 1:155015425-155015447 GGGAGGCAGTTCCTGTGGGAGGG - Exonic
918704354 1:187641754-187641776 GAAGTGTAATTGCTGTGGGTTGG - Intergenic
918863407 1:189862037-189862059 GATGGCTTATTGCTGTGGGAAGG + Intergenic
919257101 1:195139332-195139354 GAGAAGTTTTTCCTGTGGGAAGG - Intergenic
919519500 1:198570290-198570312 CATGAGTATTTCCTGTGGGAAGG + Intergenic
921731684 1:218586154-218586176 GAGGGCTGATTCCTCTGGCAGGG - Intergenic
923312544 1:232748999-232749021 GAAGGGTAGTTTCGGTGGGAGGG - Intergenic
924552599 1:245092311-245092333 CAGGAGTATTTTCTGTGGGATGG + Intronic
1067050249 10:43011970-43011992 TAGTGATAATTCCTCTGGGATGG - Intergenic
1070098038 10:73357757-73357779 GAGAGATAATTCCAGGGGGAAGG - Intronic
1076487684 10:130835302-130835324 GTGGGGTACTCCCTGTGGGTGGG - Intergenic
1076487718 10:130835427-130835449 GAGGGGTGCTCCCTGTGGGTGGG - Intergenic
1076487732 10:130835463-130835485 GAGGGGTGCTCCCTGTGGGTGGG - Intergenic
1076487745 10:130835499-130835521 GTGGGGTACTACCTGTGGGTGGG - Intergenic
1076487781 10:130835607-130835629 GTGGGGTACTCCCTGTGGGTGGG - Intergenic
1076487852 10:130835875-130835897 GTGGGGTACTCCCTGTGGGTGGG - Intergenic
1077868079 11:6239574-6239596 GAGGAGCAATTCCCATGGGAGGG + Intronic
1079123892 11:17705093-17705115 GAGGGGAAATTCCTGGAAGAAGG + Intergenic
1079241223 11:18723493-18723515 GAGGGGCAATGACTGTGAGAAGG + Intronic
1081758717 11:45562211-45562233 GCAGGAAAATTCCTGTGGGATGG - Intergenic
1081764821 11:45603135-45603157 GAGGGGTGAGTCCTGTTGGCTGG + Intergenic
1084116595 11:67046126-67046148 GAGGGGGGATTCCTGCAGGAGGG + Intronic
1084920986 11:72469416-72469438 GAGGGGTAATTCATAGTGGAAGG + Intergenic
1085234909 11:75006911-75006933 GAGGGGTAAGTCATGTGAAAAGG - Exonic
1089653799 11:119932771-119932793 GAGGGGAAATTCCTGAGTCATGG - Intergenic
1090277521 11:125430258-125430280 GAGGGATAATCACTGTGGCATGG - Intronic
1090989741 11:131805294-131805316 GAGAGGAAATTTCTGTGGGAAGG - Intronic
1091389496 12:117487-117509 GAGGAGGCCTTCCTGTGGGATGG + Intronic
1092114146 12:5986624-5986646 GAGGGGTTAATCCTGAAGGAGGG - Intronic
1095201186 12:39386310-39386332 TGGGGGTAATACCTGAGGGATGG + Intronic
1096722382 12:53532825-53532847 TTGGGGCAATTTCTGTGGGAAGG + Intronic
1097100136 12:56582048-56582070 GCTGGGTAAAACCTGTGGGAAGG - Exonic
1097181651 12:57175201-57175223 GAGGGGTGCTCCCTGTGGGAAGG + Intronic
1097493173 12:60296025-60296047 GAGGGGTGCGTCCTGTGGTATGG - Intergenic
1098954507 12:76675818-76675840 GAGGGGTCATTCCTCATGGATGG - Intergenic
1100245973 12:92757378-92757400 GAGTGTGAAGTCCTGTGGGATGG + Intronic
1104305265 12:127604705-127604727 GAGAGGAAACTCCAGTGGGATGG + Intergenic
1107676254 13:42800492-42800514 GAGTCGTGATTCCTGTGGCATGG + Intergenic
1110788316 13:79559868-79559890 GGGTGGTAACCCCTGTGGGATGG - Intergenic
1112629197 13:101141727-101141749 AAGGGTTCATCCCTGTGGGAAGG + Intronic
1115336542 14:32248298-32248320 GAGGGGTGTGTCCTGTGGTATGG + Intergenic
1117154388 14:52923579-52923601 GAGGTGGAATTCATGGGGGAGGG - Intronic
1118335117 14:64846921-64846943 GAGGAGTGGTTCATGTGGGAAGG + Intronic
1121423978 14:93835057-93835079 GAGGGCTAATGCCTGGAGGAGGG + Intergenic
1123921718 15:25074754-25074776 GAAGGGTAGTGGCTGTGGGAAGG + Intergenic
1124219259 15:27835291-27835313 GTGGGATAAATCATGTGGGATGG - Intronic
1128785668 15:70395134-70395156 GAGGTGGAATTCCTGGGAGAAGG + Intergenic
1130300170 15:82674480-82674502 CAGGGGTCATTCCTAGGGGAGGG + Intronic
1132215749 15:100060478-100060500 GTGGGGGCATTCCTGAGGGAAGG + Intronic
1132520143 16:383390-383412 GAGGTGGAATTCCCGAGGGAAGG - Intronic
1135268603 16:21049723-21049745 GCGGGGTAATTCAGATGGGATGG - Intronic
1138566024 16:57833443-57833465 CAGGGCTCATTCCTGTGGGAGGG - Intronic
1141033244 16:80607513-80607535 CAGGGGAATATCCTGTGGGAAGG - Intronic
1141941300 16:87277923-87277945 TAGGGGGAAGTCGTGTGGGAAGG - Intronic
1142372735 16:89692031-89692053 GAGGTGGAATTCCTGTGGTGGGG + Intronic
1144968097 17:19090271-19090293 CAGCGGAAATTGCTGTGGGATGG + Intergenic
1144979820 17:19161792-19161814 CAGCGGAAATTGCTGTGGGATGG - Intergenic
1144988402 17:19216440-19216462 CAGCGGAAATTGCTGTGGGATGG + Intronic
1146587475 17:34094694-34094716 GTGGAGAAATTCCTGTGAGATGG - Intronic
1146891132 17:36507128-36507150 GAGGCGGCATTCCTGTGGGATGG + Exonic
1148765143 17:50034552-50034574 GGGGGATCATTCCTGAGGGATGG - Intergenic
1151189974 17:72391199-72391221 GAATTGTAGTTCCTGTGGGAGGG - Intergenic
1151577129 17:74958497-74958519 GAGGGGTCACTCGGGTGGGAGGG + Intronic
1152361029 17:79832973-79832995 GAAGGGGAATTCCTGCGGGGGGG - Intergenic
1153059852 18:983601-983623 CAGGGGTACTACCTGTGGAATGG - Intergenic
1155214656 18:23632452-23632474 GAGAGGAAATTACTATGGGAAGG + Intronic
1161116734 19:2501167-2501189 GAGGGGAGATCCCAGTGGGAGGG + Intergenic
1163454034 19:17395451-17395473 GAGGGGGACTTTCTGTAGGAGGG - Intergenic
1164695724 19:30242063-30242085 GAGGGGTAATTCCTGTGGGAGGG + Intronic
1166424716 19:42667369-42667391 GAGGGGCAATTCCTATGTGCCGG - Intronic
925307450 2:2859259-2859281 GAGAGGTGACTCCTATGGGAAGG - Intergenic
926531612 2:14054031-14054053 GAGGGATTAGTCCTGTGGGGAGG - Intergenic
927424114 2:22962422-22962444 GAGGGGCAGTTGCTCTGGGAAGG - Intergenic
927895555 2:26779466-26779488 GAGGGGTATTTCCAGTGGATGGG - Exonic
929386686 2:41416109-41416131 GAGGGCTCATTCCTTTGTGAAGG - Intergenic
929549666 2:42881438-42881460 GAAGGGTAATTACTGAGGCAGGG - Intergenic
931803894 2:65785972-65785994 GATTGGTGGTTCCTGTGGGAGGG + Intergenic
933068838 2:77833304-77833326 GAGGGGCATGTCCTGTGGTATGG - Intergenic
935691991 2:105740432-105740454 GCTGGCTAATTCCTGTGGGAGGG + Intergenic
935892119 2:107689746-107689768 AAGGGATAACTGCTGTGGGATGG + Intergenic
936080230 2:109428002-109428024 GCTGGGTAAGTCCTGTGGAAGGG - Intronic
944878351 2:203985814-203985836 GAGGGGTAATCTCCTTGGGATGG + Intergenic
946689685 2:222300863-222300885 CAGCGGTAATTGCTGTGTGAAGG + Intronic
947660353 2:231861928-231861950 GAGGGGAAATACATGTTGGACGG + Intergenic
948768134 2:240233755-240233777 GAGGGGTAGATGCTGTGGGCAGG - Intergenic
948912062 2:241009757-241009779 AAGGGGTTGTTCCAGTGGGAGGG - Intronic
1169532734 20:6503081-6503103 GAATAGAAATTCCTGTGGGAGGG - Intergenic
1169781525 20:9315557-9315579 GAGGGGACATTGCTGTGGGTTGG + Intronic
1170166421 20:13364403-13364425 GGGAGGTAATTCCTTAGGGAAGG + Intergenic
1172195992 20:33091975-33091997 GAAGGGAATATCCTGTGGGAAGG + Intronic
1175182023 20:57155440-57155462 GAGCGGTACTTCCTTTGGGGTGG + Intergenic
1175353224 20:58341263-58341285 GTGGGATAATTGCTGTGGAATGG + Intronic
1176343172 21:5716645-5716667 GAGGCCAAATTCCTCTGGGAAGG - Intergenic
1176475426 21:7148796-7148818 GAGGCCAAATTCCTCTGGGAAGG - Intergenic
1176501655 21:7607811-7607833 GAGGCCAAATTCCTCTGGGAAGG + Intergenic
1176537493 21:8114714-8114736 GAGGCCAAATTCCTCTGGGAAGG - Intergenic
1181315190 22:21966411-21966433 GAGTGGTACTTCCCCTGGGACGG - Intronic
1182737755 22:32543141-32543163 GAGTGGGCATTCTTGTGGGAGGG - Intronic
1183163474 22:36130445-36130467 GAGGGGCAATTCCTTCAGGAAGG + Intergenic
1203242436 22_KI270733v1_random:31070-31092 GAGGCCAAATTCCTCTGGGAAGG - Intergenic
954846494 3:53563199-53563221 CAGTGGTCATCCCTGTGGGAGGG - Intronic
958077687 3:88704257-88704279 GATGGGTATTTACTGTGGAATGG + Intergenic
959705148 3:109332563-109332585 CAGCGGTAATTCCCCTGGGATGG - Intronic
960220263 3:115099563-115099585 GAGGGGTAGTTGCTGAGGGTGGG - Intronic
961623023 3:128239582-128239604 GAGGGGTGCTGCCTGTGGGCAGG - Intronic
961772882 3:129263158-129263180 GAGGGATAATGCCTGTTGGCAGG + Intronic
962693865 3:137928562-137928584 GAGGGACAATACCTGTGGCAGGG - Intergenic
963286145 3:143436275-143436297 GAGGGGGCATGCCTGTGAGAAGG - Intronic
963290454 3:143481795-143481817 GACTGGTAATTACTGTGGGACGG + Intronic
964278735 3:155038142-155038164 GAGGTGACATTCTTGTGGGAAGG - Intronic
966480622 3:180404414-180404436 GAGGAGTAATCCCAGTGGGAAGG + Intergenic
966883597 3:184362720-184362742 GAGGGGTAATGCCCGGGGGAGGG + Intronic
967293501 3:187944272-187944294 GAGGGGTCATTCCTCTGGGAAGG + Intergenic
967817451 3:193811457-193811479 GAGGGGAAATGACTGTGGGCAGG + Intergenic
973602259 4:52553535-52553557 GTGGGGCCAGTCCTGTGGGAAGG - Intergenic
974074014 4:57152163-57152185 CAGTGGTAATTTCTGTGGAAGGG - Intergenic
985034891 4:185828723-185828745 GAGGGGCAATTGATGTGGGGAGG - Intronic
986026761 5:3858396-3858418 GAGGGGTAGCTGCTGAGGGAAGG + Intergenic
990157013 5:52888892-52888914 GTGTGGTATTTCCTCTGGGATGG + Intronic
991501116 5:67278677-67278699 GAGGGGAAATCCCTGTGGGATGG + Intergenic
997754407 5:136382784-136382806 GAGGGAGGATTGCTGTGGGAGGG - Intronic
998156858 5:139792058-139792080 GAGGGGGAATGAGTGTGGGAGGG + Intergenic
999353110 5:150896135-150896157 GAGGGGTGATTTCTGGGAGAAGG + Exonic
999355991 5:150931456-150931478 GAGGGGTGATTTCTGGGAGAAGG + Intergenic
999861790 5:155655776-155655798 GAGGGGCAATTCCTGAGCCATGG + Intergenic
1001128705 5:169045222-169045244 GAGGGGTGACTCCTGTAGGCTGG + Intronic
1006222252 6:32501175-32501197 GAGGGGAGATCTCTGTGGGATGG - Intergenic
1006481740 6:34300337-34300359 GAAGGGGAATGCCTGTGGGCTGG - Intronic
1009437129 6:63631794-63631816 GAGGGGGCATTCCTGTCAGAAGG + Intergenic
1010988472 6:82452314-82452336 GAAGGGTGATACCTGTGGGCTGG - Intergenic
1015551989 6:134421113-134421135 GATGAGTAATTCCTCTGTGAAGG - Intergenic
1015844206 6:137502120-137502142 GAGAAGTAATGCCTTTGGGAAGG + Intergenic
1016033307 6:139359821-139359843 GAAAGCTAACTCCTGTGGGAAGG + Intergenic
1018992740 6:168686486-168686508 GAGTGGCACTTCCAGTGGGATGG + Intergenic
1019317169 7:392038-392060 GTTGGGTAAGTCCTGTGGGTGGG + Intergenic
1024255514 7:47537383-47537405 GAGGGCTAATTCGTGTCAGATGG - Intronic
1028577230 7:92365728-92365750 GATGGGTAATTCAGGTGGGAGGG + Intronic
1035119110 7:156550073-156550095 GAGGGGATATGACTGTGGGATGG - Intergenic
1035714626 8:1744450-1744472 GAGGGGGACTTCCTGGAGGAAGG + Intergenic
1036211259 8:6842998-6843020 CAGGGGTAAGCCCGGTGGGAAGG + Intergenic
1037134976 8:15449641-15449663 GAGGCTGAATTCCTGTGGGATGG - Intronic
1039741321 8:40385569-40385591 GACAGGTGATTCCTCTGGGAGGG - Intergenic
1047498569 8:125425990-125426012 GAGAGGGAATTCCAGTGGGAGGG + Intergenic
1055056440 9:72028598-72028620 CAGGGGGATTTGCTGTGGGAAGG - Intergenic
1057174453 9:92985837-92985859 GAGGGGTGTGTCCTGTGGTATGG + Intronic
1058398833 9:104589939-104589961 GAGAGATAATTGGTGTGGGAGGG - Intergenic
1059028094 9:110658880-110658902 AAGGGGAAATTCCCGTGGAAGGG + Intergenic
1059697059 9:116739482-116739504 GAGGGCAAATTCCAGAGGGAGGG - Intronic
1203458764 Un_GL000220v1:14147-14169 GAGGCCAAATTCCTCTGGGAAGG - Intergenic
1185744886 X:2564656-2564678 GAGGGTACATTCCTCTGGGAAGG - Intergenic
1192604639 X:72502993-72503015 GAGGTGTAGTTTCTGTGGTATGG - Intronic
1193208849 X:78781818-78781840 AAGGGGTAATTACTATGTGAAGG - Intergenic
1194122435 X:89977041-89977063 AAGGGGTATGTCCTGTGGTATGG - Intergenic
1195063702 X:101220196-101220218 GAGGGGAAATGACTGAGGGAGGG + Intronic
1195220053 X:102738176-102738198 AAGGGGCAAGTCCTGTGGTATGG + Intronic
1198197134 X:134373930-134373952 GAGGGCTAACTCTTGGGGGAGGG + Intronic
1200475296 Y:3634480-3634502 AAGGGGTATGTCCTGTGGTATGG - Intergenic
1201486194 Y:14496771-14496793 GAGGGGTGGTGGCTGTGGGATGG + Intergenic