ID: 1164696236

View in Genome Browser
Species Human (GRCh38)
Location 19:30246581-30246603
Sequence TGCCAGACCTCTTGTGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 156}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164696236_1164696245 -8 Left 1164696236 19:30246581-30246603 CCCACCCCACAAGAGGTCTGGCA 0: 1
1: 0
2: 0
3: 12
4: 156
Right 1164696245 19:30246596-30246618 GTCTGGCACTCGAGGGTGGGCGG 0: 1
1: 0
2: 0
3: 9
4: 151
1164696236_1164696247 -2 Left 1164696236 19:30246581-30246603 CCCACCCCACAAGAGGTCTGGCA 0: 1
1: 0
2: 0
3: 12
4: 156
Right 1164696247 19:30246602-30246624 CACTCGAGGGTGGGCGGTTTGGG 0: 1
1: 0
2: 0
3: 1
4: 87
1164696236_1164696246 -3 Left 1164696236 19:30246581-30246603 CCCACCCCACAAGAGGTCTGGCA 0: 1
1: 0
2: 0
3: 12
4: 156
Right 1164696246 19:30246601-30246623 GCACTCGAGGGTGGGCGGTTTGG 0: 1
1: 0
2: 0
3: 4
4: 81
1164696236_1164696248 8 Left 1164696236 19:30246581-30246603 CCCACCCCACAAGAGGTCTGGCA 0: 1
1: 0
2: 0
3: 12
4: 156
Right 1164696248 19:30246612-30246634 TGGGCGGTTTGGGATGCGTGAGG 0: 1
1: 0
2: 1
3: 8
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164696236 Original CRISPR TGCCAGACCTCTTGTGGGGT GGG (reversed) Intronic
902744083 1:18461597-18461619 TGCAGGGCCGCTTGTGGGGTGGG - Intergenic
905490669 1:38341018-38341040 TGCCAGGCATTTTGTGGAGTGGG + Intergenic
908289072 1:62643007-62643029 TGTAAGACCTCTTGTGGCCTTGG - Intronic
908560996 1:65306446-65306468 TGCCACATCACTTTTGGGGTGGG - Intronic
910227247 1:84948228-84948250 TGCCAGACTTGTTGTCGGGCTGG - Intronic
911288782 1:96029241-96029263 TGCCAGTGCTCTTGGGGGCTGGG - Intergenic
916308205 1:163363608-163363630 TGGCAGCCATCTTGTGGAGTTGG + Intergenic
916770141 1:167899772-167899794 TGGCATACCTCTTTTGGGCTCGG + Intronic
917697072 1:177536117-177536139 TTCAAGATCTCTTGTGAGGTAGG - Intergenic
918418503 1:184337503-184337525 ACCCAGGCCTGTTGTGGGGTGGG - Intergenic
921012704 1:211159189-211159211 TTCAAGATCTCTTGTAGGGTAGG + Intergenic
921500815 1:215900777-215900799 CGCCAGACCTCATCTGGAGTTGG + Exonic
923990040 1:239426158-239426180 TACCGGGCCTGTTGTGGGGTGGG - Intronic
1064853183 10:19733910-19733932 TGCCTCACCTCTGGTCGGGTGGG - Intronic
1065520271 10:26565444-26565466 TGGTATATCTCTTGTGGGGTTGG - Intronic
1068905789 10:62320275-62320297 TGCCAGATCTCTTAAGGGCTGGG + Intergenic
1069949541 10:72009577-72009599 AGCCAGGCCTCATCTGGGGTAGG + Exonic
1070565712 10:77602630-77602652 TGACAGACAGCTTGTGGGGCAGG - Intronic
1071459883 10:85882608-85882630 TCCCGGAACTGTTGTGGGGTTGG + Intronic
1074405941 10:113180537-113180559 CACGGGACCTCTTGTGGGGTAGG + Intergenic
1074897559 10:117790681-117790703 TCCCAGAGCTCTGCTGGGGTTGG - Intergenic
1075073491 10:119334804-119334826 TGTCAGTCCTGTTGGGGGGTGGG - Intronic
1075337280 10:121617573-121617595 TGCCTGAGCTGTTGTGGGGAGGG - Intergenic
1076750923 10:132542568-132542590 TGGCAGCCCTCGAGTGGGGTGGG + Intronic
1080560479 11:33458139-33458161 TGAGAGACCCCTTGTGGTGTGGG + Intergenic
1083925519 11:65803816-65803838 TTCCAGAGCTCCTGTGGGTTTGG - Intergenic
1084296952 11:68218470-68218492 CGCTACACATCTTGTGGGGTGGG - Intergenic
1084722410 11:70915684-70915706 AGGCAGCCCTTTTGTGGGGTGGG - Intronic
1088788749 11:113205546-113205568 TCCCGGAACTCCTGTGGGGTTGG - Exonic
1090165330 11:124540614-124540636 TCCCAGACCTCTTCTGTGATTGG + Intergenic
1090397525 11:126429034-126429056 TGCCTCACCTATTGTGGGGTGGG + Intronic
1091196712 11:133737817-133737839 TCACACACCTGTTGTGGGGTAGG + Intergenic
1092678822 12:10954085-10954107 TTCAGGACCTCTTGTGAGGTGGG - Intronic
1093239918 12:16657783-16657805 TTCAAGACCTCTTGTAAGGTGGG + Intergenic
1094287541 12:28812313-28812335 TGGCAGACATCTTGTGAGGCAGG - Intergenic
1096226524 12:49869818-49869840 TGACAGAGCTCTTTTGGGGCAGG - Exonic
1096716733 12:53495879-53495901 TGCCACACTTCCAGTGGGGTGGG + Intronic
1098800443 12:74950669-74950691 CACCAGGCCTGTTGTGGGGTGGG + Intergenic
1101524312 12:105514020-105514042 ACCCAGGCCTGTTGTGGGGTGGG - Intergenic
1106544338 13:30717215-30717237 AGCCAGACCTCTTTTTGGGCAGG + Intronic
1106661081 13:31800187-31800209 TGCCAGACTTCTTGGAGGGTGGG - Intronic
1107430269 13:40334229-40334251 TGCCCCACCTCTGCTGGGGTGGG - Intergenic
1107721586 13:43253898-43253920 AGCCATACCTCTTGTGAGGCAGG + Intronic
1108999358 13:56778387-56778409 TGCCAGACTGCTAGTGGGGCAGG - Intergenic
1110619507 13:77579119-77579141 TGCCAGACTTCTTGAAGGATGGG - Intronic
1110758239 13:79201191-79201213 AGTAAGACCACTTGTGGGGTTGG - Intergenic
1110878387 13:80539371-80539393 TCCAGGACCTGTTGTGGGGTTGG - Intergenic
1113835793 13:113327816-113327838 TGCCACACCACCTGTGGGGTTGG - Intronic
1113910516 13:113839168-113839190 TCCCAGGCCACCTGTGGGGTAGG + Intronic
1114609663 14:24030552-24030574 ACCCGGGCCTCTTGTGGGGTGGG + Intergenic
1115764298 14:36607060-36607082 GGCCAGGACTCTGGTGGGGTTGG - Intergenic
1119228630 14:72962891-72962913 TGCCAGAACTCTAGTGTGGGTGG + Intergenic
1124088861 15:26578974-26578996 TGCAAGACCTCTTGAGGTGGAGG + Intronic
1126323876 15:47454047-47454069 TGCAAGACCTGTGGTGTGGTTGG + Intronic
1126554930 15:49976069-49976091 CGCCATACCTCTTTTGGGGAGGG - Intronic
1128316572 15:66662999-66663021 TGCCAGCACTCTGGTGGGGTCGG - Intronic
1128867015 15:71121630-71121652 TGTCAGACTACTTGTGGGCTGGG + Intronic
1128886886 15:71296327-71296349 TGCCAGACCTCAGGTGGGTAGGG - Intronic
1129966960 15:79744575-79744597 TGCCAGAACTCTAGTGTGGGTGG + Intergenic
1130028210 15:80288206-80288228 TGCCAGGCCTCTTAAGGGCTAGG - Intergenic
1130802079 15:87275477-87275499 CACCAGGCCTGTTGTGGGGTGGG - Intergenic
1134172432 16:11978554-11978576 TGCAAGAGCTCATGTGGGGTAGG + Intronic
1134641619 16:15833636-15833658 TGGCAGACCTCTTGTGCTCTTGG - Intronic
1135536215 16:23296435-23296457 TGACAGCCCTCGAGTGGGGTGGG - Intronic
1135565069 16:23505685-23505707 GGCCAGACCTGGGGTGGGGTGGG - Intronic
1137701031 16:50497863-50497885 AGACAGAGCTGTTGTGGGGTGGG - Intergenic
1140520222 16:75574703-75574725 TGCCTGACCTTTTGTTGGGGGGG - Intronic
1141928589 16:87185508-87185530 TGGGAGCCCCCTTGTGGGGTAGG - Intronic
1147238100 17:39072301-39072323 TCCCAGACCTCCTGCTGGGTGGG - Intronic
1153967382 18:10194302-10194324 GGCCATGCCTGTTGTGGGGTGGG + Intergenic
1158513948 18:58115554-58115576 TTCCAGAACTCTGGTGGGGAAGG + Intronic
1158516617 18:58135926-58135948 GGCCATACCCCTTGTGTGGTTGG + Intronic
1160527817 18:79547714-79547736 GGCCAGCCCTCCTGTGGAGTGGG - Intergenic
1160547844 18:79672807-79672829 TGCCAGTCCTCTTGTAAGGAGGG + Intergenic
1160594741 18:79965267-79965289 AGCCAGTCCTCTTGTGGGCCTGG - Intronic
1161570055 19:5025576-5025598 AGCCTGCCCTCCTGTGGGGTTGG - Intronic
1161696681 19:5772685-5772707 TGCAAAACCGCTTGGGGGGTGGG - Intronic
1162707009 19:12562673-12562695 TGACAAACCTCTAGTGGGATGGG - Intronic
1163322730 19:16584031-16584053 AGCCAGACCTCTTGTGGTCTTGG - Intronic
1164618120 19:29678631-29678653 TGCCAGTCCCCTTCTTGGGTGGG + Intergenic
1164696236 19:30246581-30246603 TGCCAGACCTCTTGTGGGGTGGG - Intronic
927805765 2:26145194-26145216 TACCCCAACTCTTGTGGGGTTGG + Intergenic
929544058 2:42844256-42844278 TGCCAGGGCACTTGTTGGGTTGG + Intergenic
929667717 2:43846227-43846249 TGCCAGAATTCTTGTGAGCTGGG + Exonic
929894607 2:45947743-45947765 TTCCAGACTTCTTGTGGTGATGG + Intronic
930222753 2:48761735-48761757 ACCCAGACCTTTTGTGGGGGTGG - Intronic
930542996 2:52730862-52730884 TCACACACCTGTTGTGGGGTGGG - Intergenic
932754236 2:74394857-74394879 TGCCAGGCCTCAGGTGGGATGGG + Intergenic
933768445 2:85727834-85727856 TGGCAGACCTAGCGTGGGGTGGG - Intergenic
934727944 2:96637303-96637325 CGGCAGACCTCTGGTGGGGACGG + Intronic
935459389 2:103310837-103310859 ACCTGGACCTCTTGTGGGGTGGG - Intergenic
937406527 2:121634455-121634477 TACTAGACCTCTTTTGGGGTGGG - Intronic
938407166 2:131039101-131039123 TGCCAGAGCTGTTTTGGGCTTGG - Intronic
941680596 2:168394488-168394510 TGCCAACCCTTTTGTTGGGTTGG + Intergenic
942425138 2:175852169-175852191 TGTCAGTCCTCTGGTGGGGAAGG + Intergenic
944984084 2:205154880-205154902 ACCCAGGCCTGTTGTGGGGTGGG + Intronic
946187385 2:217988677-217988699 AGCCAGACCTCTTGGGAGGAGGG + Intronic
946793682 2:223327353-223327375 TGACAGTTCACTTGTGGGGTGGG - Intergenic
946849880 2:223895480-223895502 TGCGTGACCACTTGTGGGGGTGG - Intronic
947335990 2:229083835-229083857 TGGCAGCTCTCTTGTGGCGTTGG - Intronic
1169481950 20:5990635-5990657 TGCCTGACTTCTTGTGGGTATGG + Intronic
1177132694 21:17277387-17277409 AGCAGGACCTGTTGTGGGGTGGG + Intergenic
1178697935 21:34810061-34810083 AGCCAGACCTCTGGTGGGAGAGG + Intronic
1181148508 22:20865938-20865960 AGCTTGACCTCTGGTGGGGTTGG - Intronic
1181596562 22:23918791-23918813 TGCCGGACTTGCTGTGGGGTTGG + Intergenic
1182236727 22:28882755-28882777 TTCCAGACTTCTTTTGGGGGCGG + Intergenic
1183161004 22:36113105-36113127 TGCCAGATCTCTTAAGGAGTAGG - Intergenic
1183298522 22:37046452-37046474 TGCCAGGCCGGTTGTGGGGAGGG + Intergenic
1185108661 22:48888501-48888523 TGCCAGACCTCTAGTTAGGATGG + Intergenic
950420700 3:12897358-12897380 TGCCAGGCTTCTTGTGAGGGAGG + Exonic
950567698 3:13780810-13780832 AGCCAGGCCACTTGTGGGGCTGG + Intergenic
951012798 3:17700030-17700052 TGCCAGAACTCTAGTGTGGGTGG - Intronic
952640914 3:35594437-35594459 TACCGGGCCTGTTGTGGGGTAGG + Intergenic
952833380 3:37584281-37584303 TGTGAGACCTCTTAAGGGGTAGG + Intronic
953173830 3:40531267-40531289 TGCAAGACCTCTTGTAGTGCTGG + Intronic
956243619 3:67156250-67156272 TTCAGGACCTCTTGTAGGGTAGG - Intergenic
963509475 3:146229323-146229345 TGCCTGACCTCCAGGGGGGTGGG + Intronic
966251284 3:177867689-177867711 TCCAAGACCTCTTGTAGGGTAGG - Intergenic
966313178 3:178616745-178616767 TGCCCTGCCTCCTGTGGGGTTGG + Intronic
969672629 4:8598188-8598210 TCACAGAGCTCTTGTGGGATGGG - Intronic
970712899 4:18885036-18885058 TGCAATACCTCTTGTGGCATAGG - Intergenic
974982479 4:68976683-68976705 CTCAATACCTCTTGTGGGGTGGG - Intergenic
975479848 4:74865783-74865805 ACCCAGGCCTGTTGTGGGGTGGG + Intergenic
976513994 4:85943615-85943637 CACCAGGCCTGTTGTGGGGTGGG - Intronic
978648482 4:110971237-110971259 TGCCAAAGTTTTTGTGGGGTGGG - Intergenic
985426228 4:189833356-189833378 TGCCAGACACCTAGTGGGCTCGG + Intergenic
990226392 5:53660152-53660174 TCCGGGACCTGTTGTGGGGTGGG - Intronic
996891653 5:128428035-128428057 TGACAGATCAGTTGTGGGGTAGG - Intronic
999586375 5:153094027-153094049 TTCCTGACCTCTTGTGGGGCTGG + Intergenic
999961436 5:156760336-156760358 TTCCAGGCTTCTTTTGGGGTAGG - Intronic
1000480858 5:161772037-161772059 TGCGGGGCCTGTTGTGGGGTGGG + Intergenic
1000563259 5:162816607-162816629 TGCGGGGCCTGTTGTGGGGTGGG + Intergenic
1000888376 5:166774297-166774319 TCCGAGGCCTGTTGTGGGGTGGG - Intergenic
1003474621 6:6469969-6469991 TGCAAGACCTCTTGAGGCTTGGG - Intergenic
1005398370 6:25406729-25406751 AGCCAGACCTATTGTGGGAAGGG + Intronic
1006451561 6:34108626-34108648 TGGCAGACCTGATTTGGGGTGGG + Intronic
1008115645 6:47546327-47546349 TCCCAGACTTCTTGGGGGCTTGG - Intronic
1012148731 6:95718751-95718773 TTCCAGACCTGTTATGGGGGAGG + Intergenic
1021038329 7:15829107-15829129 TACCCGTCCTCTTGTGGAGTTGG + Intergenic
1023141118 7:37103505-37103527 ACCCAGGCCTGTTGTGGGGTGGG + Intronic
1023860451 7:44215039-44215061 TGCCAGACCTGGGTTGGGGTGGG + Intergenic
1026142035 7:67714566-67714588 CTCCAGACCTACTGTGGGGTGGG + Intergenic
1027445463 7:78268578-78268600 TGCCATACCCCTAGTGGGTTTGG + Intronic
1030874136 7:114792429-114792451 TGCCAGACCCCTGGAGTGGTGGG - Intergenic
1033624389 7:143094257-143094279 ACCGAGACCTGTTGTGGGGTGGG + Intergenic
1034066415 7:148140879-148140901 GGCCAGACCTCTTGAGGGCAAGG + Intronic
1034936404 7:155203356-155203378 GGCCAGACCTCCTGAGGGGAGGG + Intergenic
1040996365 8:53407091-53407113 TCCCTGACCTGTTCTGGGGTGGG - Intergenic
1042606414 8:70550930-70550952 TCCCAGACCACCTGTGGGGAGGG + Intergenic
1044116010 8:88335033-88335055 TGCCAGACCTTTTTTGGGGGGGG + Intergenic
1047496507 8:125412757-125412779 TGCTAGTCCTCTGGAGGGGTAGG + Intergenic
1051488192 9:17631471-17631493 TGCCAGAAATCTTGTTTGGTGGG - Intronic
1052150420 9:25107967-25107989 CACCACACCTGTTGTGGGGTGGG + Intergenic
1058990669 9:110253081-110253103 TACGAGACCTCTTGTGGCGGTGG - Intronic
1059308018 9:113369851-113369873 TGCCAGAACCCTTGCGGGGCAGG - Exonic
1059496464 9:114713754-114713776 TGCCAAACATCCTGAGGGGTGGG - Intergenic
1059672709 9:116506677-116506699 TGCCTGACTTTTTGGGGGGTTGG - Intronic
1061531206 9:131214879-131214901 TGGTGGATCTCTTGTGGGGTTGG + Intronic
1186339059 X:8623603-8623625 TGCCAAAGCTTTTGTGAGGTAGG - Exonic
1186595090 X:10972518-10972540 TGCCAGAAGTCTCCTGGGGTGGG + Intergenic
1189065178 X:37800118-37800140 TGCCAATCCTCTTGTGGGCAGGG + Intronic
1189335377 X:40168015-40168037 TGCCAGAGCTCTGGTGGGGGAGG - Intronic
1190446159 X:50526470-50526492 ACCCAGACCTGTTGTGGGGTAGG + Intergenic
1190568150 X:51752002-51752024 TTCCAGACTTCTTATGGGGAGGG + Intergenic
1193695529 X:84703057-84703079 ACCCAGGCCTGTTGTGGGGTGGG + Intergenic
1196388986 X:115190044-115190066 GCACAGCCCTCTTGTGGGGTGGG - Exonic
1197667600 X:129240479-129240501 TGTGAGACATCTTGTGTGGTTGG - Intergenic
1199714340 X:150495632-150495654 AGCCAGACCTCTTCCAGGGTGGG + Intronic
1200750674 Y:6941591-6941613 TGCCAGAACAATTGTGGAGTGGG + Intronic