ID: 1164700650

View in Genome Browser
Species Human (GRCh38)
Location 19:30281664-30281686
Sequence CTGTGCTTTAAGAGGGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 228}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164700637_1164700650 26 Left 1164700637 19:30281615-30281637 CCTCCTAAGCTCATCCATGTTGC 0: 1
1: 0
2: 6
3: 14
4: 176
Right 1164700650 19:30281664-30281686 CTGTGCTTTAAGAGGGAAGCAGG 0: 1
1: 0
2: 2
3: 20
4: 228
1164700644_1164700650 12 Left 1164700644 19:30281629-30281651 CCATGTTGCTGGGGAGGGCTGCG No data
Right 1164700650 19:30281664-30281686 CTGTGCTTTAAGAGGGAAGCAGG 0: 1
1: 0
2: 2
3: 20
4: 228
1164700638_1164700650 23 Left 1164700638 19:30281618-30281640 CCTAAGCTCATCCATGTTGCTGG 0: 1
1: 1
2: 9
3: 52
4: 287
Right 1164700650 19:30281664-30281686 CTGTGCTTTAAGAGGGAAGCAGG 0: 1
1: 0
2: 2
3: 20
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164700650 Original CRISPR CTGTGCTTTAAGAGGGAAGC AGG Intronic
903250322 1:22048624-22048646 CTCTGCTTGCAGTGGGAAGCTGG + Intergenic
904606238 1:31699406-31699428 CTGAGGTTGAAGAGGCAAGCAGG + Intronic
905233741 1:36531060-36531082 CTGGGCTGTAACTGGGAAGCTGG + Intergenic
906860561 1:49354400-49354422 CAATGAGTTAAGAGGGAAGCTGG - Intronic
907761735 1:57368044-57368066 CTTTGCTTCAAGATGGGAGCAGG - Intronic
908775042 1:67631700-67631722 CTGGGCGTGTAGAGGGAAGCTGG + Intergenic
911758599 1:101589854-101589876 CTGTACTCTAAAAGGAAAGCAGG - Intergenic
912337010 1:108872634-108872656 CTTTGCTTTAAGATGAAACCAGG - Intronic
912432074 1:109633256-109633278 CTTTGTTTTAACAAGGAAGCAGG + Intergenic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
915244668 1:154547859-154547881 CTCTCTTTTGAGAGGGAAGCTGG - Exonic
916696845 1:167246284-167246306 CTTTGCTTTAGGAGGAAAGGGGG - Intronic
918081805 1:181213614-181213636 CTGTGGTCTGAGAGGGAAGAAGG + Intergenic
922132678 1:222795198-222795220 CTTTGCTTCAAGATAGAAGCAGG - Intergenic
1063358700 10:5429236-5429258 CTTTTCTTTAACAGGGCAGCAGG - Intronic
1064214940 10:13392339-13392361 TTGTGCTTTGAGTGGGAAGGTGG + Intergenic
1065644077 10:27816345-27816367 CTGTTCTGTATGAGGGAAACAGG + Intronic
1065801645 10:29357865-29357887 CTCTGCTTTAACATGGATGCTGG - Intergenic
1066249302 10:33617439-33617461 CTGTTCTTGAAGAGGGAAGGTGG - Intergenic
1067934051 10:50593062-50593084 CTCTGTTTTCGGAGGGAAGCTGG + Intronic
1068150788 10:53127892-53127914 CTTTGCCTTAAGATGAAAGCAGG + Intergenic
1069016959 10:63441028-63441050 CTGTGCTTTAAAAGGACAGTAGG + Intronic
1073664740 10:105518170-105518192 CTTTGCTTAAAGAGTGTAGCTGG - Intergenic
1073741301 10:106410172-106410194 CTGTTTTTGAAGATGGAAGCGGG + Intergenic
1073857412 10:107693532-107693554 CTGTTCTTTAAGAGGCCAGGAGG - Intergenic
1077456966 11:2687145-2687167 CTGTGCTTTGTGGAGGAAGCTGG - Intronic
1079467354 11:20743616-20743638 CTGTGGGGTAAGAGGAAAGCAGG - Intronic
1080026234 11:27618019-27618041 CTGTCCTTTAAGAGAAAAGCTGG + Intergenic
1080947047 11:36984930-36984952 CTCTGCTTTAGAAGGGAATCAGG - Intergenic
1082071477 11:47943279-47943301 CTTTGCTTTAAGAGGCAGGGTGG + Intergenic
1083267999 11:61555748-61555770 CGGTGCTTTATGCGGGAGGCAGG + Intronic
1083603368 11:63962271-63962293 CTGTGCTTTCAGAGGGCAGCTGG - Intergenic
1088070274 11:105775097-105775119 CTGGGCTTTAAGATGGAGGAAGG - Intronic
1088785049 11:113173860-113173882 CTGTGCTTTATGAGTAAAGATGG + Intronic
1089962584 11:122629032-122629054 CTGTGCAGTAAGAGGGAGGCAGG + Intergenic
1090011178 11:123047221-123047243 CTGTGGTTTTAGTGGGAAGCAGG - Intergenic
1090213016 11:124936114-124936136 CTGTGTATTCAGAGGGAAGTTGG - Exonic
1091233855 11:134006326-134006348 CTGTGATTTAAGAGGCCAGGAGG - Intergenic
1091565881 12:1647573-1647595 CCGTGCTTTAACAGGGACCCAGG - Intergenic
1093238750 12:16642498-16642520 CTGTTTTATAAGGGGGAAGCTGG - Intergenic
1098899655 12:76099812-76099834 CTTTGTTTAAAGGGGGAAGCTGG + Intergenic
1101717855 12:107326623-107326645 CTGAACTTTAAGTTGGAAGCAGG - Intronic
1101833332 12:108276451-108276473 CTCTGCTCTAAGAGGGAAGCAGG + Intergenic
1102406257 12:112676724-112676746 GTGTGCTCTAAGAGGGAGACGGG - Intronic
1102726543 12:115070618-115070640 GTGTCCTTAAAGAGAGAAGCAGG - Intergenic
1104082602 12:125443548-125443570 CTGTGCTTTAAGAGGGTTTTAGG + Intronic
1105063192 12:133172777-133172799 CTGGGATGTGAGAGGGAAGCAGG + Intronic
1105417305 13:20224561-20224583 CAGTGCATTAACAGGGAAGGAGG - Intronic
1105952903 13:25247611-25247633 CAGTGCTTAAATATGGAAGCAGG + Exonic
1106626436 13:31425363-31425385 CTGGGGTTGAAGAGGGAATCAGG + Intergenic
1107136355 13:36948102-36948124 CTGTGCTTAGAAAGGTAAGCTGG + Intergenic
1109399691 13:61809168-61809190 GTGTGCTTGAGTAGGGAAGCTGG + Intergenic
1109421052 13:62113181-62113203 CTGTGCTTGAATAGGCAAGAAGG - Intergenic
1110150497 13:72246932-72246954 CTGTACTTTAAAAAGAAAGCAGG + Intergenic
1111081025 13:83308066-83308088 CAGTACTTTTAGAAGGAAGCTGG - Intergenic
1112993995 13:105549732-105549754 CTTTGCTTTAGGATGGAAACAGG - Intergenic
1115566866 14:34631697-34631719 CTGTGTTTTAGGAGGAAAACTGG - Intergenic
1117316877 14:54579756-54579778 CTGGGCTTGAGGAGGGAAACAGG + Intronic
1117352048 14:54890899-54890921 CTGTGTAGTCAGAGGGAAGCTGG - Intronic
1118031242 14:61820321-61820343 CTTTGATTTAAGAGGCAAGAGGG + Intergenic
1118081152 14:62362213-62362235 CTGTTCTTGAGGATGGAAGCTGG + Intergenic
1119800890 14:77444085-77444107 CTGTGCTTTAAGGGCTTAGCTGG - Intronic
1120646479 14:87080486-87080508 ATGTGCTTTATGAGTGAAACTGG - Intergenic
1120882273 14:89422815-89422837 GCTTACTTTAAGAGGGAAGCAGG + Intronic
1122297620 14:100714136-100714158 CTGTGGTTGCAGAGGGAAGCCGG - Intergenic
1124201127 15:27679320-27679342 CGGTGTTTTAAGAGGGTGGCAGG + Intergenic
1124997115 15:34734556-34734578 CAGAGCTTTAAGAGAGGAGCGGG + Intergenic
1126102617 15:45129102-45129124 GTGTGATTAAAGAGGGAACCAGG + Exonic
1126246250 15:46509345-46509367 CTTTGGTCTAAGAGGGATGCTGG + Intergenic
1126817310 15:52466537-52466559 CTGGGGTGTAAGAGGGAAGCAGG + Intronic
1128460007 15:67859857-67859879 CTGTCCTTTAAGACTCAAGCAGG - Intergenic
1129047736 15:72751782-72751804 CCGTGCTTTATGATGGCAGCAGG - Exonic
1130100794 15:80892436-80892458 CTGGGTTTTAAGAGAGAAGGTGG - Intronic
1134352715 16:13452836-13452858 ATATTCTTTAAGAGGGAAGAGGG - Intergenic
1134890179 16:17834594-17834616 ATGTGCTATAATAAGGAAGCTGG + Intergenic
1135159585 16:20081985-20082007 CTGGGCTTTAGGAGGCAGGCAGG - Intergenic
1136514068 16:30757204-30757226 CTGGTCTTCAAGAGGGTAGCAGG - Exonic
1137892092 16:52173531-52173553 CTCTGCTTAAAGAAGGAAGGAGG + Intergenic
1138499187 16:57428353-57428375 GTGAGCATTTAGAGGGAAGCAGG - Exonic
1142620231 17:1160971-1160993 CGGTGCCTTCTGAGGGAAGCGGG + Intronic
1144554865 17:16273255-16273277 CTGAGCTTTAAGAGACAAGTAGG + Intronic
1144991913 17:19238539-19238561 CTGTGCTTTAAGAGCGGAGAGGG + Intronic
1146931145 17:36778805-36778827 CTGTGCTGGAGGAGGGCAGCTGG - Intergenic
1147199379 17:38789765-38789787 ACGTGCTTTGAGAGGGATGCTGG + Intronic
1147685999 17:42287364-42287386 CTGTGCTGTGAGTGGGCAGCTGG + Intergenic
1148616389 17:49003831-49003853 CTCCCCTTTAAAAGGGAAGCGGG - Intronic
1148752498 17:49953283-49953305 AGGTGGTTTAAGAGGGATGCTGG + Intergenic
1149030613 17:52078699-52078721 TTGTGTTCTAAGTGGGAAGCAGG + Intronic
1149258074 17:54849608-54849630 ATGTGCATTAAGAGGGAAAGTGG + Intergenic
1150296188 17:64008880-64008902 CCTTGCTTGAAGAGGGAATCAGG - Intronic
1150483722 17:65530238-65530260 ATCTGCTTTAAGACGGCAGCTGG + Intronic
1150731078 17:67694458-67694480 CTGAGCACTGAGAGGGAAGCAGG - Intronic
1151711220 17:75808057-75808079 CTTTCCTGAAAGAGGGAAGCTGG - Intronic
1151817440 17:76478240-76478262 CAGTGCTTTGAGGGGGCAGCAGG - Intronic
1151968829 17:77446649-77446671 GCGTCCTTTAAGAGGGAGGCAGG - Intronic
1152115351 17:78383193-78383215 CTGAGTTATAAGAGGGAAACAGG + Intronic
1152264547 17:79286751-79286773 CTGTGCGTTAACATAGAAGCTGG + Intronic
1153686113 18:7547259-7547281 CTGTGCTTTCAGTGAGAAACAGG + Intergenic
1155513569 18:26601139-26601161 ATGAGCATTTAGAGGGAAGCAGG + Intronic
1158684519 18:59600938-59600960 CCTTGCTTTCAGAGGGAAGAAGG + Intronic
1159225077 18:65523189-65523211 CTGTGCTTGAAGAGAGAAGAGGG + Intergenic
1159232128 18:65622130-65622152 GTGTACTTTAAGAGGCAGGCAGG - Intergenic
1159888054 18:73928118-73928140 CTGGGCTCTCAGTGGGAAGCAGG + Intergenic
1161204436 19:3033721-3033743 CTGTGCTTAGAGAGGGAAGAGGG - Intronic
1162936015 19:13981978-13982000 CTGGGAGTGAAGAGGGAAGCAGG + Intronic
1164700650 19:30281664-30281686 CTGTGCTTTAAGAGGGAAGCAGG + Intronic
1165528672 19:36378622-36378644 CTGTTCTTTAGGAAGGCAGCGGG - Intronic
1168513834 19:56994373-56994395 CTGGCCTTGAAGAGGGAAGCTGG + Intergenic
925598889 2:5588086-5588108 CTGTGCTTTGGGATGAAAGCAGG + Intergenic
926052440 2:9753717-9753739 CTGTGTGCTAAGAGGGAAGCTGG + Intergenic
926708840 2:15859033-15859055 CTGTGCTTTTAGAGGTCACCTGG - Intergenic
927219557 2:20694673-20694695 CTGTGCCTGCAGAGAGAAGCAGG - Intronic
927346674 2:22052079-22052101 ATGTGGCTTAAGAGGTAAGCAGG - Intergenic
927510267 2:23639952-23639974 CTGCACTTCAAGAGGGATGCAGG - Intronic
927832099 2:26360649-26360671 CTGTGCTTTAAGATGGATGGTGG + Intronic
931593544 2:63913993-63914015 CTGTGGAGTAAGAAGGAAGCAGG + Intronic
931845765 2:66202406-66202428 CTGTGCTTTGAGAAAGAAGCAGG + Intergenic
934559293 2:95304289-95304311 CAGTACTGTAAGTGGGAAGCCGG + Intronic
934654127 2:96108573-96108595 AGCTGCTTTAAGAGGGAAGAGGG - Intergenic
935304912 2:101728087-101728109 CTGTACTTAAAGAGGTAACCTGG - Intronic
939601890 2:144202698-144202720 CTGTGTTTTAAAAGACAAGCTGG - Intronic
941051614 2:160740730-160740752 ATGAGCCTTAACAGGGAAGCTGG + Intergenic
941452067 2:165671921-165671943 CTGTGCTTTAACAAAGAGGCTGG - Intronic
942455059 2:176131748-176131770 CTGTGCTTTGAGAGGGATTTGGG + Exonic
943016558 2:182517573-182517595 CTGTGGTTGAATAGGGAAGGTGG + Intronic
943162808 2:184277512-184277534 CTGTGCATTGTGAAGGAAGCAGG + Intergenic
943843699 2:192613336-192613358 GTGTGCTTACTGAGGGAAGCTGG + Intergenic
946028752 2:216688929-216688951 ATGTGCTTCCAGAGGGCAGCTGG - Intronic
948592222 2:239058412-239058434 CTGTGCTTTAAGTGGAAACGTGG - Intronic
1169339268 20:4783787-4783809 CTGTGTTTAGAGAGGGAAGAGGG - Exonic
1170869795 20:20195175-20195197 CTGTGCTTTGTGACAGAAGCTGG + Intronic
1174138734 20:48398347-48398369 CTTTGCTTCAAGAATGAAGCTGG + Intergenic
1174419902 20:50392652-50392674 CAGTGCTTTAGGAGGCAAGGTGG + Intergenic
1176023151 20:62972876-62972898 TTGTCCTTTAAGGGGGAGGCAGG - Intergenic
1176388305 21:6150676-6150698 CTCTGCTGGAAGTGGGAAGCTGG + Intergenic
1178405869 21:32322846-32322868 CTGTGCTGTAGGACGGTAGCTGG - Intronic
1179390237 21:40982343-40982365 CTGTGTTTTGAGAGTAAAGCAGG - Intergenic
1179399648 21:41071700-41071722 CTGTAGCTTAAGAGGGAGGCAGG - Intergenic
1179401791 21:41091070-41091092 CTGTGGTTCATGAGGGAAGCGGG - Intergenic
1179735167 21:43387572-43387594 CTCTGCTGGAAGTGGGAAGCTGG - Intergenic
1182095652 22:27623494-27623516 CTGTCCTTTAGGGGGGAGGCTGG + Intergenic
1182712831 22:32333270-32333292 CTGTGCTGGAAGTGGGCAGCAGG + Intergenic
1183250783 22:36729011-36729033 GAGCCCTTTAAGAGGGAAGCTGG + Intergenic
1183566378 22:38618219-38618241 CTCTGCTTTTAGATGGAAACTGG - Intronic
1183927954 22:41219237-41219259 CTGTCCTTGAAGAGCTAAGCCGG - Intronic
1184321156 22:43743215-43743237 CTGACCTTTAAGATGAAAGCCGG + Intronic
1184400075 22:44268634-44268656 CTGTGCTGCAAGTGGGCAGCAGG + Intronic
950173618 3:10856290-10856312 CTGCGGGTTGAGAGGGAAGCAGG + Intronic
950797156 3:15519511-15519533 CTGTGCTTGAAAAGGCAAGAGGG - Intronic
952953076 3:38539624-38539646 TTGGGCTTTAAGAGGGAAATAGG + Intronic
953179959 3:40585802-40585824 CTGTGCTTTAGGCATGAAGCTGG - Intergenic
953609094 3:44432774-44432796 CAGGGATGTAAGAGGGAAGCTGG - Intergenic
953758866 3:45671215-45671237 CTGAGCATTCAGAGGAAAGCTGG + Intronic
954172390 3:48815394-48815416 TTATGCTTTAAAAAGGAAGCTGG + Intronic
955059489 3:55483329-55483351 CTGGGATTGAAGAGGGAAGAGGG - Intronic
956712211 3:72048638-72048660 CTCTGCTGTGTGAGGGAAGCAGG + Intergenic
959069816 3:101691823-101691845 AAGTGCTTTAAAAGGGAGGCTGG + Intergenic
959575478 3:107928335-107928357 CCGTGCTTTGAGACGGAAGGAGG - Intergenic
961085420 3:124063279-124063301 ATGTGATTTAAGAGGGCAACAGG + Intergenic
962247299 3:133806172-133806194 CTGGGCGTTAAGGGGGATGCCGG + Intronic
963843614 3:150132755-150132777 CTGTGCAGGAAGAGGGAAGGGGG + Intergenic
964401308 3:156302198-156302220 CAGTCCTTTAAGAGGCAGGCAGG - Intronic
964886708 3:161491853-161491875 CTGTGTTTAAATCGGGAAGCAGG + Intergenic
965468281 3:169059471-169059493 CTGTCCTTGAACAGGGAAGGTGG - Intergenic
966909274 3:184549704-184549726 CAGTTGTTTAAGATGGAAGCAGG + Intronic
967716720 3:192771153-192771175 CTGTGCTTGGAGTGGCAAGCAGG - Intergenic
968684071 4:1944520-1944542 CTGTGCTTGGAGAGGGGAGGTGG + Intronic
971854076 4:32021747-32021769 CTGTCCTTTGATAAGGAAGCAGG + Intergenic
972027910 4:34410487-34410509 CTGTGCTTTAAGAGTGTGGTTGG + Intergenic
972259788 4:37396488-37396510 CTATTCTTTACAAGGGAAGCAGG + Intronic
972782861 4:42301182-42301204 CTGTGCTTCAAGAGGGCCTCGGG + Intergenic
973611330 4:52638283-52638305 CTGGCCTTGAAGAGGGAAGAAGG + Intronic
974188965 4:58477938-58477960 CTGTCTTTTAAGAAGCAAGCTGG + Intergenic
974326659 4:60423025-60423047 ATGTGCTTTAAGAGGCAAAATGG + Intergenic
974483398 4:62475067-62475089 CAGTGCTTTCAGAGGGAACATGG - Intergenic
975369548 4:73568640-73568662 TTGTGCTTGAGGAGGGAAGAAGG - Intergenic
977041091 4:92020035-92020057 CTGTTCTTAAATAGGGAAGAAGG - Intergenic
978444113 4:108764234-108764256 CTGTGTTTTGAAAGGGCAGCAGG + Intergenic
979569246 4:122198081-122198103 TGGTGCTGTAAGAGGAAAGCAGG + Intronic
981504424 4:145482992-145483014 ATGTGCTTTAGGAGGGGAGGAGG + Exonic
981647932 4:147020878-147020900 GTGTGCTTTAACAGGGATGGTGG - Intergenic
981734955 4:147938995-147939017 ATTTGCTTTAAGAGGGAAAAAGG - Intronic
984225967 4:177035243-177035265 CTTTGCTTTACGAGGGAAGTGGG + Intergenic
984934602 4:184879344-184879366 CTATGGTTTAAGCTGGAAGCAGG - Intergenic
986327615 5:6688238-6688260 GGGTCCTTTAAGAGGGAGGCAGG + Intergenic
986371171 5:7081579-7081601 CGGTGCTGTAAGAGGGAGGCTGG + Intergenic
987470353 5:18320419-18320441 CTTTGCTATAAGGGGGATGCTGG + Intergenic
989317673 5:40102029-40102051 CAGTGATATAAGAGGGGAGCAGG + Intergenic
989727984 5:44610303-44610325 ATGTGCTTCAAGAGGGAAGGAGG + Intergenic
992415444 5:76548353-76548375 CTGTGCTTTAAGACAGATGAAGG - Intronic
994257865 5:97621626-97621648 CTGTGCTTTGAGAATGAAGTTGG + Intergenic
995874001 5:116771257-116771279 CTGTACCTGAAGAGGGAATCTGG - Intergenic
996338226 5:122408145-122408167 CTCCACTTTAAGAGGGATGCTGG - Intronic
1003850521 6:10217889-10217911 GTGTGCTTTAAGATGGAATAAGG + Intergenic
1003904515 6:10687136-10687158 CTCTGCTATTAGAGTGAAGCAGG - Exonic
1005672449 6:28120740-28120762 CTGTGCACTAAAGGGGAAGCAGG + Intergenic
1008662853 6:53686795-53686817 CTGTGCTGTAAGAGTGATTCTGG - Intergenic
1009955096 6:70444154-70444176 TAGTGCTTTGGGAGGGAAGCAGG + Intronic
1010784030 6:79979030-79979052 CTGTGCTAGATGAGGGAAGATGG - Intergenic
1013592423 6:111630639-111630661 CTGGGCTTTAACAGGGAAAGTGG - Intergenic
1014075312 6:117228490-117228512 CAGTCCTATAAGAAGGAAGCTGG + Intergenic
1017115884 6:150975935-150975957 TTGTGGCTTAAGGGGGAAGCGGG + Intronic
1019133549 6:169894440-169894462 CCAAGCTTTAAGAGGGATGCAGG - Intergenic
1020225292 7:6274737-6274759 CTGTGCTTTAATGGGGAAATTGG + Intergenic
1022220133 7:28306394-28306416 CTATAGTTTCAGAGGGAAGCTGG - Intronic
1023892307 7:44401895-44401917 CTGTGCCTTAAGAGGATAGCTGG - Intronic
1023951654 7:44850802-44850824 GGGTGCTTTAAGAGAGAAACAGG + Intergenic
1024303347 7:47904694-47904716 CTATACTTTAAGAGGAAGGCGGG + Intronic
1024891629 7:54210621-54210643 CTCTGCTTGAAGAGAGAAGAGGG + Intergenic
1026796527 7:73369427-73369449 GTGGGCATCAAGAGGGAAGCTGG - Intergenic
1028902743 7:96119186-96119208 CTGCTCTTTAAGAGGCAGGCAGG + Intergenic
1030521524 7:110603897-110603919 CTGTGCTTTAAGAAGAGAGTAGG + Intergenic
1030642523 7:112022441-112022463 CTGCTCCTTGAGAGGGAAGCAGG + Intronic
1030851136 7:114487708-114487730 CTGTGCTTTAGCAAGGAAACTGG - Intronic
1031706624 7:124988567-124988589 CTGTGCTTTAGAAGGGAACCAGG - Intergenic
1032716676 7:134514666-134514688 CTCTGTTTTAAGACGGAAACTGG - Intergenic
1033817992 7:145098553-145098575 CTGTGTGTTTATAGGGAAGCTGG + Intergenic
1034088125 7:148338910-148338932 CTGTGCTCTGAGAGTGAAGGAGG + Intronic
1034092897 7:148380820-148380842 CTGTGCTCTAATATTGAAGCAGG + Intronic
1037594362 8:20342587-20342609 CTGTGCTTTGAGAGGTAAAGAGG + Intergenic
1038482612 8:27912039-27912061 CTGAGCTTTCAGAGGGAACGTGG + Intronic
1041329562 8:56710322-56710344 CTGTGCTTTGTGAGTGAAGATGG + Intergenic
1041605601 8:59779439-59779461 ATGTGCATTAAGAGGCAAGATGG + Intergenic
1045175463 8:99718994-99719016 CTGTGCATTAAAAAGGAAACTGG - Intronic
1045643993 8:104282482-104282504 CTGTGCTTTGAGAGAGATGGTGG - Intergenic
1047435135 8:124829809-124829831 CTGTGCTTTAAGAGATATTCTGG + Intergenic
1047511768 8:125521091-125521113 CTTTGCCTGAAGAGGGAAGGAGG + Intergenic
1048008827 8:130440628-130440650 GTGAGGTTTGAGAGGGAAGCAGG - Intronic
1048210199 8:132448471-132448493 CTGAGCTCTAAGGGGGAAGAAGG + Intronic
1050040794 9:1491210-1491232 CTGAGCTGTAAGAGTGATGCTGG + Intergenic
1053366732 9:37528093-37528115 CTGTGCTTTAGGAGAATAGCTGG - Intronic
1056150056 9:83776941-83776963 CAGTGCTATAAGAAGGAAGTAGG + Intronic
1057291191 9:93808573-93808595 CTGTCCTTTAACAGTGGAGCTGG - Intergenic
1057528719 9:95825321-95825343 CTGTGCTTCCCCAGGGAAGCAGG - Intergenic
1057815010 9:98287692-98287714 CTGTGCTTTCAGAGGAGCGCAGG + Intergenic
1058136746 9:101316124-101316146 CTGTGCTTTAACTGGGAAGAGGG - Intronic
1058283834 9:103151188-103151210 CTGTGTTGTGAGAGGGATGCAGG + Intergenic
1059107340 9:111523138-111523160 CTGTGCATCAGGAAGGAAGCAGG - Intergenic
1059715146 9:116906403-116906425 CTGTGCTTTTCGGGAGAAGCAGG + Intronic
1062730437 9:138105422-138105444 CTGTGCTTTCAGAGGGATCAAGG + Intronic
1186320220 X:8416177-8416199 ATGTCCTTTAAGAGAGAGGCAGG - Intergenic
1186415837 X:9382422-9382444 CTGGGCTATGAGAGGGAAGTGGG - Intergenic
1186600260 X:11029160-11029182 CTGAGCTATATGAGGGAAGATGG + Intergenic
1187702285 X:21974270-21974292 CTGTAGTTAAAGAGGAAAGCAGG + Intronic
1188061583 X:25607188-25607210 CTGGGCCTGAAGAGGGAGGCAGG - Intergenic
1188115057 X:26232433-26232455 CTGTGCTTTAACAAGGAGACTGG - Intergenic
1188584917 X:31762213-31762235 CTGTACTTTAAAATGGAAGAAGG - Intronic
1189561106 X:42192199-42192221 ATCTGATTTAAGAGGGAAACTGG + Intergenic
1193316385 X:80070716-80070738 CTGTGGTTTAAGAGTGTGGCTGG + Intergenic
1194006757 X:88504260-88504282 CTCTGCTTTAGGAGAGAAGAGGG + Intergenic
1198718797 X:139592755-139592777 CTGTGGGTTCAGAGTGAAGCAGG + Intronic