ID: 1164705631

View in Genome Browser
Species Human (GRCh38)
Location 19:30317353-30317375
Sequence AGGGGCTCTCCTAATGCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 148}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164705631_1164705638 -1 Left 1164705631 19:30317353-30317375 CCCCAGGCATTAGGAGAGCCCCT 0: 1
1: 0
2: 1
3: 7
4: 148
Right 1164705638 19:30317375-30317397 TTGCAGGTGCCTCTGAGTTCAGG 0: 1
1: 0
2: 1
3: 23
4: 184
1164705631_1164705642 15 Left 1164705631 19:30317353-30317375 CCCCAGGCATTAGGAGAGCCCCT 0: 1
1: 0
2: 1
3: 7
4: 148
Right 1164705642 19:30317391-30317413 GTTCAGGGCAGACACATGGTAGG 0: 1
1: 0
2: 1
3: 12
4: 169
1164705631_1164705639 0 Left 1164705631 19:30317353-30317375 CCCCAGGCATTAGGAGAGCCCCT 0: 1
1: 0
2: 1
3: 7
4: 148
Right 1164705639 19:30317376-30317398 TGCAGGTGCCTCTGAGTTCAGGG 0: 1
1: 0
2: 5
3: 19
4: 265
1164705631_1164705641 11 Left 1164705631 19:30317353-30317375 CCCCAGGCATTAGGAGAGCCCCT 0: 1
1: 0
2: 1
3: 7
4: 148
Right 1164705641 19:30317387-30317409 CTGAGTTCAGGGCAGACACATGG 0: 1
1: 1
2: 0
3: 18
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164705631 Original CRISPR AGGGGCTCTCCTAATGCCTG GGG (reversed) Intronic
900245698 1:1635076-1635098 AGGAGCTCCCCTCCTGCCTGGGG + Intronic
900256928 1:1702233-1702255 AGGAGCTCCCCTCCTGCCTGGGG + Intronic
901255709 1:7824793-7824815 AGAGACTCTCCTAACTCCTGAGG - Intronic
901306269 1:8235228-8235250 AGGAGCTCTCCTAAGTGCTGGGG + Intergenic
904299698 1:29546403-29546425 AGTGGCTCTCCTAGTGCCACAGG + Intergenic
905712876 1:40121749-40121771 CGGGGCTCTCCAAGTGGCTGTGG - Intergenic
906151821 1:43591974-43591996 AGGGGGTCTCCTGGTCCCTGAGG + Intronic
906175068 1:43764236-43764258 AGGGGCCCTCAAAATGTCTGTGG + Intronic
906691022 1:47792831-47792853 GGGGGCTCCCCTTAGGCCTGGGG + Intronic
908410289 1:63857587-63857609 ATGTGCTCTCCCCATGCCTGGGG - Intronic
908439092 1:64135462-64135484 CAGGGCTCTGCTAATGCCTAGGG + Intronic
915564519 1:156706195-156706217 TCGGGCTCACGTAATGCCTGGGG + Intergenic
918203838 1:182291609-182291631 AGGGTCTCTCTCAGTGCCTGGGG + Intergenic
918393666 1:184092522-184092544 AGGGGCTCTCAAAAGGACTGGGG + Intergenic
922109173 1:222540773-222540795 AGAGGCTCTGCCAATGACTGTGG + Intronic
922551565 1:226498033-226498055 AGGGGCACTCCTGAGGCCAGAGG + Intergenic
923002674 1:230020553-230020575 AAGAGCTCTCCTAATGCTGGAGG + Intergenic
1063918569 10:10909192-10909214 AGGGGCTGTCCTTTTGACTGAGG + Intergenic
1065886309 10:30080654-30080676 GGGGGCTGTCCTAATGACTGGGG - Intronic
1074707380 10:116146901-116146923 AGGGCCTCTCCTAGGGCTTGTGG + Intronic
1076131866 10:128019083-128019105 AGGGGATGCCCCAATGCCTGGGG - Intronic
1076499405 10:130924493-130924515 AGGAGCTCTCCCACTGGCTGAGG - Intergenic
1077269563 11:1669125-1669147 TGGGGCTCTTCTTATGCCTCGGG + Intergenic
1077389431 11:2292901-2292923 AGGGGCTCTCCTCTTCTCTGGGG - Intergenic
1077508577 11:2943512-2943534 AGGGGCACTCCCCAAGCCTGTGG + Intergenic
1078553150 11:12294128-12294150 AGGGGCTCTCCTGCTGCCCTAGG - Exonic
1081696164 11:45110547-45110569 AGGGGCTCTCCTCTGACCTGGGG + Intronic
1081758474 11:45560833-45560855 AGGGGCACTCCTAAGGCAGGAGG - Intergenic
1083812132 11:65112043-65112065 AGGGGCCCTCCGAATTCCAGCGG - Exonic
1085023285 11:73222208-73222230 AGAGGCTCTCCTCAGACCTGGGG - Intronic
1085388874 11:76172165-76172187 AGGTGCTCCCCAAATCCCTGAGG + Intergenic
1090408328 11:126490917-126490939 AGGGGGTCCACAAATGCCTGAGG + Intronic
1092847028 12:12593108-12593130 AGGGGCCTTCAGAATGCCTGTGG + Intergenic
1096025742 12:48359549-48359571 AGGAGCTCTCCTCAAGACTGAGG - Intergenic
1100130989 12:91493131-91493153 AGAGGCTCTGCGAATTCCTGAGG - Intergenic
1104024896 12:125018553-125018575 CGGGCCTCTCCTAGTGTCTGCGG - Intronic
1104780982 12:131420443-131420465 AGGGGCTCTGCTCAAGCCTCAGG + Intergenic
1106419558 13:29574487-29574509 AGGAGCTCACCCAATACCTGTGG + Intronic
1107268564 13:38586823-38586845 AGAGGCCCTCCTATTGCATGGGG - Intergenic
1109886989 13:68556043-68556065 AGGGCCTATCCAAATGCCAGAGG + Intergenic
1113148335 13:107234279-107234301 AGGGGCTCACCTAAGCCCCGGGG - Intronic
1121524183 14:94607126-94607148 AGGGCCTGTACCAATGCCTGGGG + Intronic
1122306981 14:100772665-100772687 GGGGGCTCTCCACATACCTGTGG + Intergenic
1126780691 15:52136720-52136742 AGGCACTCTGCTAATGCATGAGG + Intronic
1131375959 15:91923482-91923504 ACTGGCTCTCCTCCTGCCTGGGG - Intronic
1132708730 16:1257263-1257285 AGGGACTCTCCAAACCCCTGGGG - Intronic
1135408232 16:22213719-22213741 AGGGGCTGTCCTCATTCCTTGGG + Intronic
1138275256 16:55729693-55729715 AGGGACTCTGCTAATACCCGAGG - Intergenic
1138886026 16:61080379-61080401 AGGGCCTCTCCTTATGACTTAGG + Intergenic
1141692640 16:85605277-85605299 AAGGCCTCTCCTAATGTCGGAGG + Intergenic
1142195973 16:88739476-88739498 GGGGGCTCTCCTGGTGGCTGAGG + Intronic
1142347727 16:89564839-89564861 AGGGCCTTTCCTGCTGCCTGCGG + Exonic
1144780224 17:17804415-17804437 AGGGGCTCAACAAATGCTTGCGG - Intronic
1146382275 17:32340022-32340044 AGGGGCTCTTTTAAGGACTGGGG + Intronic
1148238197 17:45983266-45983288 TGGGGCTCCCCTCCTGCCTGAGG + Exonic
1148485482 17:47988064-47988086 AGGGGAACCCCAAATGCCTGAGG + Intergenic
1148813948 17:50313271-50313293 AGGCTCTCTCCTACAGCCTGGGG - Intergenic
1148853044 17:50563951-50563973 AGGGACCCTCCTGAAGCCTGTGG - Intronic
1150797986 17:68254893-68254915 AGAGGTTCTCCAAAGGCCTGGGG - Intronic
1152324948 17:79630545-79630567 AGGGGCTCTCCAAATGCCAGTGG + Intergenic
1152575632 17:81139629-81139651 TTGGGCTCTCATAAGGCCTGCGG - Intronic
1153168086 18:2285009-2285031 AGGGCCACACCTAATGCTTGTGG + Intergenic
1153961712 18:10145669-10145691 AAGGGCTCTCCCAAGCCCTGGGG + Intergenic
1158271949 18:55726096-55726118 AGGGTATCTCCCAAGGCCTGGGG - Intergenic
1159746522 18:72242918-72242940 AGGTGCTCTTGTGATGCCTGTGG + Intergenic
1163455222 19:17402666-17402688 AGAGCCTCTCCTGATTCCTGGGG - Intergenic
1164705631 19:30317353-30317375 AGGGGCTCTCCTAATGCCTGGGG - Intronic
1164937931 19:32229465-32229487 AGCCGGTGTCCTAATGCCTGGGG + Intergenic
1167828519 19:51997676-51997698 AGGGTATCTTTTAATGCCTGAGG + Intronic
925247617 2:2398667-2398689 AGGGTTTGTCCTCATGCCTGGGG - Intergenic
926635100 2:15170186-15170208 AGGGGTTCTGTTAACGCCTGCGG + Intronic
929911856 2:46096964-46096986 AGGGGCTCGGCCAGTGCCTGAGG + Intronic
929953906 2:46440649-46440671 GGTGGCTCTCCTTCTGCCTGTGG - Intronic
933341658 2:81033771-81033793 AGAGACTCACCTAAGGCCTGTGG + Intergenic
933817564 2:86080425-86080447 AGGGACACTCTTAAAGCCTGAGG + Intronic
935340690 2:102057425-102057447 AGGGGCTTTCCTATTGCGGGAGG - Intergenic
939440448 2:142242473-142242495 AGGGTCACTCCTAATCACTGGGG - Intergenic
940586642 2:155660173-155660195 AGGATCTCTCCTAGAGCCTGTGG + Intergenic
946326692 2:218988252-218988274 TGGGGCTCTGCTGAGGCCTGTGG + Intergenic
948939309 2:241188136-241188158 GCTGGCTCTGCTAATGCCTGAGG - Intergenic
1168764691 20:373705-373727 AAAGGCTCTTCTCATGCCTGTGG - Intronic
1173582111 20:44154733-44154755 AGGGACTCTCCCCATCCCTGGGG - Intronic
1179253993 21:39699385-39699407 GGGGCCTCTGCTAATCCCTGAGG + Intergenic
1179776839 21:43669920-43669942 AGGGGCTCTTCTACTGCATGTGG + Exonic
1180864559 22:19109099-19109121 AGTGGCTATCCTAATGGGTGAGG - Intronic
1181851804 22:25754875-25754897 AGGGGCTGTCCTTAGCCCTGAGG - Intronic
1183482775 22:38074301-38074323 AGGGGCTCGCCTAGGGCCTGGGG - Exonic
1184879899 22:47298039-47298061 AGGGGCTGTCCTGGGGCCTGGGG + Intergenic
949932555 3:9090304-9090326 AGGAGCTCTGTAAATGCCTGTGG + Intronic
962661504 3:137605372-137605394 AAGGCCTCTCCTATTGCCTTCGG - Intergenic
962947002 3:140180988-140181010 AGGGTCTATCCCAATCCCTGTGG - Intronic
964445289 3:156751666-156751688 AGGGGTTCAGCAAATGCCTGGGG + Intergenic
967475622 3:189913671-189913693 AGGCTCTCTCCTAATCCCTAAGG - Intergenic
968525162 4:1053124-1053146 CGGGGCTGTCCTCATGCCTGTGG - Intergenic
968707837 4:2091333-2091355 ATGGGCTTTCTTTATGCCTGGGG - Intronic
972016420 4:34251402-34251424 ATGGGCTCTACTCATACCTGTGG - Intergenic
974410362 4:61533336-61533358 AGGTGCTGTCCTAATTCCCGTGG - Intronic
980696081 4:136357295-136357317 AAGGGCACTACTGATGCCTGTGG - Intergenic
981571360 4:146154145-146154167 AGGGACTCTCCTAATTCAGGTGG - Intergenic
983755472 4:171329285-171329307 TGGGGCTCACCCAGTGCCTGTGG - Intergenic
984847575 4:184120773-184120795 TGGGGCCATCCTAAGGCCTGGGG - Intronic
985491991 5:185691-185713 AGGGGCACAGCTTATGCCTGTGG + Exonic
986287618 5:6371430-6371452 AGGGCCCATCCTAAAGCCTGAGG + Intergenic
995871219 5:116745348-116745370 GGGGTCTTTCCTATTGCCTGAGG + Intergenic
996607834 5:125344680-125344702 AGCGGCTCTCCTGGTGCCTGGGG + Intergenic
997181076 5:131829843-131829865 AGTGCCTCCCCTAATGGCTGTGG + Intronic
998042983 5:138965089-138965111 AGGGGCTTCCCTCTTGCCTGGGG + Intronic
998488758 5:142527420-142527442 TGGGACGCTCTTAATGCCTGGGG + Intergenic
1002191978 5:177483195-177483217 AGTGGCTCCCCTCATGTCTGTGG + Intergenic
1005089608 6:22042944-22042966 AGTGGCTCTCTTAATACATGAGG - Intergenic
1006800208 6:36754841-36754863 GGGGGTTCTCATAATGACTGGGG + Intronic
1007232871 6:40360959-40360981 AAGGGCTCTTCTAATTGCTGTGG - Intergenic
1007357011 6:41328503-41328525 AGGTGCACTCCTAATGGCTCTGG + Intergenic
1007843513 6:44735728-44735750 AGGGGTTTTCCCAAGGCCTGGGG + Intergenic
1008964906 6:57304957-57304979 AGGGACTTTCCTGATGCATGTGG - Intergenic
1011498471 6:87962091-87962113 AGAGGGTCTCTTAATGCCAGGGG + Intergenic
1013070945 6:106728603-106728625 AGGGCCTCTCTTAATGCAAGTGG + Intergenic
1021211883 7:17863689-17863711 TGGGGCTTGCCTAACGCCTGTGG - Intronic
1021623796 7:22573019-22573041 AGGGGATTTCCGAAGGCCTGAGG - Intronic
1022048685 7:26644136-26644158 CTGGGCGCTCCTAAGGCCTGGGG + Intronic
1023092120 7:36627056-36627078 AGGGACTCCCAAAATGCCTGTGG - Intronic
1023212528 7:37823279-37823301 AGGGACTCTGTAAATGCCTGTGG + Intronic
1023497756 7:40816087-40816109 AGCAGCTCTCCTTCTGCCTGAGG + Intronic
1024204431 7:47144581-47144603 TGGGGCTCTCCTGGTCCCTGTGG - Intergenic
1028663671 7:93314973-93314995 AGGGGCTCTGCTTATACCTTGGG - Intronic
1030104828 7:105978316-105978338 AGGGGCTCTCTGAAGTCCTGTGG + Intronic
1030434507 7:109499772-109499794 AGGGGCTCACCAAAAGACTGAGG - Intergenic
1032514387 7:132495944-132495966 AGGGGCTCACCTAGTGCTTGGGG - Intronic
1033283699 7:140023242-140023264 AGGGTCCCTCCTAGGGCCTGGGG + Intergenic
1034469266 7:151246928-151246950 GGGGCCCCTCCTCATGCCTGGGG - Intronic
1038616424 8:29099740-29099762 AGGGGCTGTCCAAATGTGTGTGG - Intronic
1040796458 8:51294000-51294022 AAGGGAGCTCCTAATGTCTGGGG - Intergenic
1041047900 8:53904603-53904625 AGGGACTCTTCAAATGGCTGAGG - Intronic
1041323842 8:56643541-56643563 AGGGGCTCTACTAAGTTCTGGGG + Intergenic
1042369587 8:67976336-67976358 AGGGTCTCTCCACATGGCTGAGG - Intronic
1042980353 8:74519357-74519379 TGGGCCTCACCTAAGGCCTGTGG - Intergenic
1043213396 8:77552894-77552916 AGGAGCTAGCCTAAGGCCTGTGG - Intergenic
1043226029 8:77731485-77731507 AGGAACTCTCCTATTGCCTTTGG - Intergenic
1044472390 8:92584967-92584989 AGGGGATCTACTAATCCATGAGG - Intergenic
1048394373 8:134000008-134000030 AGGTGCTCTACTAATACTTGTGG - Intergenic
1048556917 8:135487558-135487580 AAGGGCTCTCCCCATGCTTGGGG - Intronic
1049521676 8:143094675-143094697 AGGTGGTCTCCCAGTGCCTGCGG - Intergenic
1050547966 9:6725019-6725041 AGAGGCTCTCCTCATTCCTTGGG + Intronic
1056335042 9:85560050-85560072 AGGGGGTCTCCAAATGCTGGTGG - Intronic
1056786082 9:89593460-89593482 AGGCGCTCAACTAATGCTTGTGG + Intergenic
1058535162 9:105950916-105950938 CAGGGCTCTACTTATGCCTGAGG + Intergenic
1058595738 9:106613530-106613552 AGGTGCTTTCCAAATGCCAGAGG - Intergenic
1059651637 9:116320920-116320942 AGGGCCTCTCCCACTACCTGCGG - Intronic
1186616038 X:11188954-11188976 AAGGGCATTCCAAATGCCTGTGG + Exonic
1187300691 X:18046547-18046569 ATGGGCTCTCCTATTCTCTGTGG - Intergenic
1189213427 X:39303520-39303542 AGGTGGGCTCCTAATGCCTTGGG - Intergenic
1193249378 X:79270586-79270608 AGAGGCGCTCCTAAAGCCTGTGG + Intergenic
1195102986 X:101574103-101574125 AGGGGCTGGCCTGATGGCTGGGG + Intergenic
1195415883 X:104619048-104619070 AGCAGCTCTCCTCCTGCCTGAGG + Intronic
1197122996 X:122913952-122913974 AGGGCCTGGCCTAAAGCCTGGGG + Intergenic
1199394786 X:147323077-147323099 ATTGGCTCTCCTAAGGCGTGAGG - Intergenic
1199691751 X:150313871-150313893 AGGGATTCTCCCACTGCCTGTGG - Intergenic