ID: 1164705851

View in Genome Browser
Species Human (GRCh38)
Location 19:30319115-30319137
Sequence TTAAAATAGAAGTCCGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 859
Summary {0: 1, 1: 1, 2: 8, 3: 75, 4: 774}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164705845_1164705851 26 Left 1164705845 19:30319066-30319088 CCCTGTCTGAGAGCGTTTTCCAG 0: 1
1: 0
2: 2
3: 5
4: 92
Right 1164705851 19:30319115-30319137 TTAAAATAGAAGTCCGGGCATGG 0: 1
1: 1
2: 8
3: 75
4: 774
1164705846_1164705851 25 Left 1164705846 19:30319067-30319089 CCTGTCTGAGAGCGTTTTCCAGA 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1164705851 19:30319115-30319137 TTAAAATAGAAGTCCGGGCATGG 0: 1
1: 1
2: 8
3: 75
4: 774
1164705847_1164705851 7 Left 1164705847 19:30319085-30319107 CCAGATCGTAGACAAATACACTG 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1164705851 19:30319115-30319137 TTAAAATAGAAGTCCGGGCATGG 0: 1
1: 1
2: 8
3: 75
4: 774
1164705844_1164705851 30 Left 1164705844 19:30319062-30319084 CCTTCCCTGTCTGAGAGCGTTTT 0: 1
1: 0
2: 1
3: 5
4: 148
Right 1164705851 19:30319115-30319137 TTAAAATAGAAGTCCGGGCATGG 0: 1
1: 1
2: 8
3: 75
4: 774

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164705851 Original CRISPR TTAAAATAGAAGTCCGGGCA TGG Intronic
900288284 1:1912445-1912467 TTAAATCAGTAGGCCGGGCATGG - Intergenic
900760675 1:4468144-4468166 TTAAAATAGAGGACAGGGCCTGG - Intergenic
901106337 1:6759260-6759282 TTAAAAATTAAGGCCGGGCACGG + Intergenic
901430984 1:9214793-9214815 TAAAAAAAGAAGGCCAGGCATGG + Intergenic
901470795 1:9455121-9455143 TTAAAATGGAATTCCGGGCTGGG + Intergenic
901571840 1:10167147-10167169 TAATAATAGAGGGCCGGGCACGG + Intronic
901575581 1:10198257-10198279 TTAAAATCGAGGTGCTGGCAGGG + Intergenic
902175213 1:14644649-14644671 TTACAAGAGAAGGCCCGGCACGG - Intronic
902407497 1:16193091-16193113 ATAAAATAACAGTCTGGGCATGG + Intergenic
902910573 1:19593970-19593992 TTAATAAATAAGGCCGGGCACGG - Intergenic
903045143 1:20558845-20558867 TGAAAATAGAGGGCCGGGCACGG + Intergenic
903208721 1:21802913-21802935 TTAAATTAGCCGTCCGGGCAAGG + Intergenic
903329733 1:22591092-22591114 TAAAAATAGAAGTGAGGGCTGGG + Intronic
903696739 1:25213136-25213158 TTATAAAAGAAGTCAGGGCCAGG + Intergenic
903836835 1:26209525-26209547 TTAAAAAAAGAGGCCGGGCATGG - Intergenic
904064339 1:27737237-27737259 ATAAAAGAGCAGGCCGGGCACGG - Intronic
904108908 1:28109574-28109596 TTAAAAAAGAAGTACTGGCCAGG - Intergenic
904161381 1:28524565-28524587 ATAAAATAAAAGGCCAGGCATGG + Intronic
904181999 1:28672511-28672533 TTAAAAAAGTAGGCCGGGCGTGG - Intronic
904243559 1:29168319-29168341 ATACAGTAGAAGGCCGGGCATGG - Intronic
904553377 1:31340236-31340258 TTAAGAAAGAAGCCTGGGCATGG - Intronic
904686350 1:32263581-32263603 TAAAAATAAAAGGCTGGGCATGG + Intronic
905425986 1:37885121-37885143 TAAAATAAGAAGGCCGGGCACGG + Intronic
905562655 1:38939836-38939858 AAAAAAAAGAAGTCCTGGCACGG - Intronic
905566404 1:38968589-38968611 AAGAAATAGAAGGCCGGGCACGG - Intergenic
905696466 1:39977993-39978015 TTAAAATAAAAGTTCAGGCCAGG - Intergenic
906229392 1:44148044-44148066 TTCAAAATGAAGGCCGGGCATGG - Intergenic
906433018 1:45771244-45771266 TTAAGAAAGTAGGCCGGGCACGG + Intergenic
906654227 1:47536186-47536208 TCAAAAAAGGAGTCTGGGCAGGG + Intergenic
907102481 1:51849524-51849546 TTGAAAAAGATGGCCGGGCACGG + Intronic
907567254 1:55446934-55446956 TAAAAATAAAAGGCCGGGCGCGG + Intergenic
908129856 1:61064391-61064413 ACAAAAGAGAAGGCCGGGCATGG + Intronic
908226313 1:62059459-62059481 TAAAAATACAAAGCCGGGCATGG + Intronic
908306082 1:62818285-62818307 TTAAAATAGAAGTCTGACCATGG - Intronic
908473100 1:64463729-64463751 TTAAGAAATGAGTCCGGGCATGG + Intergenic
909484236 1:76155765-76155787 TAAAAATAGGAGGCCGGGCGCGG - Intronic
909795980 1:79736245-79736267 TTGAAATGCAAGGCCGGGCATGG - Intergenic
909891316 1:81010929-81010951 TAAGAATAGAAGGCCGGGCGCGG + Intergenic
909971779 1:81999684-81999706 CTAAAATAGCAGGCCAGGCATGG + Intergenic
910020108 1:82577270-82577292 TAAAAATATAAGGCCGGGCGCGG - Intergenic
910160868 1:84270978-84271000 TTAAAATACAAGTTAGGGCCGGG - Intergenic
911004828 1:93208952-93208974 AAAAAATAAAAGGCCGGGCATGG - Intronic
911215800 1:95192004-95192026 AGAAAAGAGAAGGCCGGGCACGG + Exonic
911592831 1:99767674-99767696 TAATAATAGAACTCCGGGCTGGG - Intergenic
914193755 1:145432736-145432758 ACAAAATAGAAGGCCGGGCGCGG - Intergenic
914409821 1:147415787-147415809 TTAAAATAAAAGTTCAGTCATGG - Intergenic
914869354 1:151459575-151459597 CTAGAAAAGAAGCCCGGGCAGGG - Intergenic
915110679 1:153562981-153563003 AAAAAAAAGGAGTCCGGGCACGG + Intronic
915357619 1:155265269-155265291 TCAAAAAAGAAGTCCGGGCCAGG + Intronic
915498261 1:156296235-156296257 TTGAAAGAAAAGGCCGGGCACGG + Intergenic
915887534 1:159739027-159739049 TTAATAAAGAGGGCCGGGCACGG - Intergenic
915983632 1:160441144-160441166 TTAACATTTAAGGCCGGGCATGG + Intergenic
916515518 1:165512936-165512958 TGAAAATAGAGGTCTGGGAAAGG + Intergenic
916551066 1:165850418-165850440 TTAAAAAATAAGGCCGGGCACGG - Intronic
916762252 1:167827454-167827476 TTAAATCAGCAGGCCGGGCATGG - Intronic
917313943 1:173705371-173705393 TAAAAATAGACGGCCGAGCATGG + Intergenic
918334505 1:183495115-183495137 TTAAAATAAGAGGCTGGGCACGG - Intronic
918365106 1:183799190-183799212 TTAAAAAAGGAGGCCAGGCATGG - Intronic
920663666 1:207942550-207942572 TTAGAAGAGGAGTCCGGGCACGG + Intergenic
921073168 1:211678814-211678836 AAAAAAAAAAAGTCCGGGCACGG + Intergenic
921895404 1:220394906-220394928 TTAAAACAAAAGTCAAGGCAAGG + Intergenic
921961767 1:221042790-221042812 TTAAAATTTAAGGCTGGGCATGG - Intergenic
922646423 1:227291251-227291273 TTAAAAAAGAAGTCTAGGCTGGG + Intronic
923709321 1:236373203-236373225 TCAAAAAAGAAGGCTGGGCATGG - Intronic
924188031 1:241516939-241516961 TTAAAATTTAAGGCCGGGCACGG - Intronic
924362816 1:243259080-243259102 TTAAAATGGAAGTACGATCACGG - Intronic
924478630 1:244405470-244405492 AGAAAAAAGAAGGCCGGGCATGG - Intergenic
924599818 1:245478708-245478730 TTAAAATGCAAGTCAGGGCCGGG - Intronic
1063303391 10:4874267-4874289 TTAAAATTGACATCCAGGCATGG + Intergenic
1064037791 10:11928857-11928879 TTAAAAAAACAGGCCGGGCATGG + Intronic
1064266820 10:13832046-13832068 TTAGAATGGAAGTCCAGGCCAGG - Intronic
1064337910 10:14460226-14460248 TAAAAGTTGAAGGCCGGGCATGG + Intronic
1064438507 10:15332249-15332271 TTAAAATGCAAGTCCTGGCCTGG - Intronic
1064574752 10:16733193-16733215 TTAAAATAGAAAACCCGGCTGGG + Intronic
1064832422 10:19485351-19485373 ATAATAAAGAAGGCCGGGCACGG + Intronic
1065054028 10:21825065-21825087 TTAAAATAGTTGGCCGGGCGTGG - Intronic
1065345250 10:24742133-24742155 TTAAAAAATTAGGCCGGGCATGG - Intergenic
1065588077 10:27240041-27240063 TTAAAAAATAAATCCGGGCCGGG - Intronic
1065655011 10:27939423-27939445 TTAAAAATGCAGGCCGGGCACGG + Intronic
1065748731 10:28865543-28865565 TTTAAATAGAAATCAGGGAATGG + Intronic
1065960373 10:30729335-30729357 TTAAAAAAAAATTTCGGGCATGG - Intergenic
1066280292 10:33910538-33910560 TTAAAACAGAAGGCCGGGTGCGG - Intergenic
1066678306 10:37911878-37911900 TAAAAATAGAACTTCTGGCAGGG - Intergenic
1068360366 10:55969389-55969411 TTAAAAAAGAAGGCCAGGCCAGG - Intergenic
1068900303 10:62261344-62261366 TTAAAATAGCTATCCCGGCAGGG + Intronic
1068926996 10:62550902-62550924 TTATAATAAAAGTCAGGTCATGG + Intronic
1069459073 10:68577335-68577357 ATGAAATAGAAGGCCAGGCACGG - Intronic
1069470949 10:68688726-68688748 TTAAGAAAGTAGGCCGGGCACGG - Intronic
1070022654 10:72602086-72602108 TTAAAATATTACTCCAGGCATGG - Intronic
1070088758 10:73262676-73262698 TTAAAAAAGAAATTCGTGCATGG + Intronic
1070128303 10:73639415-73639437 TTAAGACAGAAGTCTGGGCCAGG - Intronic
1071541674 10:86490770-86490792 TTAAATTTGAAGGCCGGGCGCGG + Intronic
1071593923 10:86903894-86903916 TAAAAATAATAGGCCGGGCACGG - Intronic
1072144784 10:92625062-92625084 TTAAAACAGAAATACCGGCAGGG - Intronic
1072322752 10:94266915-94266937 TCAAAATAGAAGTTCTGTCATGG + Intronic
1072345950 10:94506327-94506349 TTCAAAAAGTAGGCCGGGCATGG - Intronic
1072679082 10:97492941-97492963 TTAAGATAGAAATATGGGCAGGG + Intronic
1072775849 10:98192118-98192140 TTAAAAAAAAAGTCCAGGCTGGG - Intronic
1073003006 10:100299245-100299267 TTTAAAAAGCAGGCCGGGCACGG - Intronic
1073134778 10:101214435-101214457 TTTAAAAAGAAGTCCGGGCACGG + Intergenic
1073712599 10:106061640-106061662 TTAAAAAAGAAGACAGGGCCAGG + Intergenic
1073769824 10:106724216-106724238 TAAAGATATAAGGCCGGGCATGG + Intronic
1073903170 10:108246156-108246178 TTAAAATTGAACTCGGGGGAAGG + Intergenic
1074552499 10:114457773-114457795 TAAAAATAATAGGCCGGGCATGG + Intronic
1074799682 10:116987015-116987037 TTAAAAAAATAGGCCGGGCACGG - Intronic
1074894721 10:117765306-117765328 TTAAAATAAAAGTCTGGGGTTGG - Intergenic
1075285363 10:121180678-121180700 TTAAGAGAGATGGCCGGGCATGG + Intergenic
1075347960 10:121698100-121698122 TAAAAATAAAAGGCCAGGCACGG + Intergenic
1078710213 11:13783916-13783938 TTATAAGAGAAGCCCCGGCAGGG - Intergenic
1079501734 11:21108257-21108279 TTAAATTAGAAGGCAGGGCCTGG - Intronic
1079978644 11:27124812-27124834 TAAAGAAAGAAGGCCGGGCACGG - Intronic
1079984660 11:27187814-27187836 TTACAATAGTGGTCCAGGCAAGG - Intergenic
1080019661 11:27546872-27546894 TTAAAAAACCAGGCCGGGCATGG + Intergenic
1080506886 11:32923677-32923699 TCAAAAAAAAAGGCCGGGCACGG + Intronic
1080541338 11:33268297-33268319 TTAAAATTGAATTCTGGGCCGGG + Intronic
1080545674 11:33315656-33315678 TAAAAATAGGAGTCAGGGCCAGG - Intronic
1081305388 11:41505348-41505370 TAAAAAAAGAAGGCCAGGCACGG - Intergenic
1081733337 11:45386610-45386632 TTAAAATTGTAGGCCAGGCATGG - Intergenic
1081748313 11:45488478-45488500 ATAAAGTAGGAGGCCGGGCACGG + Intergenic
1083397883 11:62403814-62403836 TTAAAAAAAAAGGCCAGGCACGG + Intergenic
1083456067 11:62779483-62779505 TAAAAATATAAGGCTGGGCACGG - Intronic
1083585408 11:63854505-63854527 ATAAAATAAAAGACTGGGCATGG - Intronic
1083915462 11:65740402-65740424 ATAAAATAAAAGGCTGGGCATGG + Intergenic
1083921514 11:65783546-65783568 ATAAAAAATAAGGCCGGGCACGG + Intergenic
1084551016 11:69842160-69842182 TTAAAATAGAACCTGGGGCACGG - Intergenic
1085290830 11:75398342-75398364 TTGAAAAAGAAGGCCAGGCACGG + Intergenic
1085538899 11:77247759-77247781 TAGAAAGACAAGTCCGGGCATGG + Intronic
1085952908 11:81354400-81354422 TAAAAATAGACGGCTGGGCATGG + Intergenic
1086277670 11:85150308-85150330 TTAAAAACGGAGGCCGGGCACGG - Intronic
1086691895 11:89796524-89796546 ATAAAATAGGAGCCCAGGCATGG - Intergenic
1086713905 11:90043132-90043154 ATAAAATAGGAGCCCAGGCATGG + Intergenic
1087024333 11:93634817-93634839 TTAAAAAAAAAGTCCTGGCTGGG - Intergenic
1087164230 11:94984563-94984585 TAAAAATAGCAGGCCAGGCATGG + Intronic
1088242783 11:107788669-107788691 TTAACAGAGATGGCCGGGCATGG + Intergenic
1088602267 11:111491455-111491477 TAAAAAGAGAAGGCCAGGCATGG + Intronic
1088635691 11:111818072-111818094 TTGAAATAGAAGTGAGGGCCAGG - Intronic
1088684286 11:112271992-112272014 TTATATTAGAAGGCCAGGCAGGG - Intergenic
1088982531 11:114876580-114876602 CGAAAATAGAAGTCCAGGCCAGG - Intergenic
1089432078 11:118433422-118433444 TAAAAATTTAAGGCCGGGCACGG - Exonic
1089460679 11:118651495-118651517 ATAAATTAAAAGGCCGGGCATGG + Intronic
1089513168 11:119013751-119013773 AAAAAAAAAAAGTCCGGGCACGG - Intronic
1089697154 11:120222934-120222956 CAAAAAAAGAAGTCCTGGCAGGG + Intronic
1090137571 11:124214324-124214346 TCAATATAGAAGTCCTGGCCGGG - Intergenic
1090145980 11:124323117-124323139 GTAAAATAGAAGTAGGGGTATGG - Intergenic
1090311188 11:125742522-125742544 TTAAAATAGGTGGCCAGGCATGG + Intergenic
1090654176 11:128830103-128830125 TTAAAATAGCAGGCTGGGCGCGG + Intergenic
1090937424 11:131356315-131356337 TTAATATATAAGGCCGGGCATGG + Intergenic
1090956200 11:131514880-131514902 ATAAAATACAAGGCCGGGCATGG - Intronic
1091570782 12:1683603-1683625 TTAAAATAAAAAGCCAGGCATGG - Intergenic
1092017341 12:5170185-5170207 TAAAAATAAAAGGCCGGGCGCGG + Intergenic
1092250862 12:6895601-6895623 AAAAAAAAGAAGGCCGGGCATGG + Intronic
1092342085 12:7685391-7685413 AAAAAAAAAAAGTCCGGGCACGG - Intergenic
1092584791 12:9888198-9888220 TTAGAATTGCAGGCCGGGCATGG + Intronic
1092887451 12:12937377-12937399 TTAAAATAAAACTCCAGGCCGGG + Intergenic
1093174239 12:15894167-15894189 TTACAATTTAAGGCCGGGCATGG + Intronic
1093451880 12:19325397-19325419 TAATAATAGAAGGCCAGGCATGG + Intronic
1093555288 12:20465702-20465724 TTAAAATAAAAGTACTGGCTGGG - Intronic
1093820776 12:23615090-23615112 TGAAAATATAAGGCCGGGTACGG - Intronic
1094153109 12:27308527-27308549 TTAAAATATAATTCCTGGCTGGG + Intronic
1094591640 12:31827221-31827243 TTAAAAAATCAGGCCGGGCATGG + Intergenic
1094679912 12:32658804-32658826 ATAAAATAGAGATCCGGGCCGGG + Intergenic
1094682192 12:32676640-32676662 AGAAAACAGAAGGCCGGGCACGG - Intergenic
1094692659 12:32785235-32785257 TTAAAAAAATAGTCCAGGCATGG - Intergenic
1096056021 12:48652816-48652838 TTAAAATAGAAGTTCAGTTAGGG - Intergenic
1096146106 12:49279986-49280008 TTAAAAAAGAACTCAGGGAAAGG + Intergenic
1096275636 12:50205361-50205383 TTAAAATACGAGCCCAGGCATGG - Intronic
1096286123 12:50302107-50302129 TTAACATACAAGGCCGGGCATGG + Intergenic
1096645978 12:53036072-53036094 AAAAAATAGAAGGCCAGGCATGG - Intronic
1096768987 12:53920815-53920837 TTAAAATAGACTTCTGGGCTTGG + Intergenic
1096798769 12:54095568-54095590 TAAAAATTGAAGTCCAGGCCAGG - Intergenic
1097771021 12:63585346-63585368 TTAAAAGAGAAGTCAGGGGAAGG + Intronic
1098460675 12:70730218-70730240 TTAAATTAGAAGGCCTGGCTTGG + Intronic
1098858400 12:75680348-75680370 TTAAAATGCAAGTCCAGGCCAGG + Intergenic
1098876439 12:75870564-75870586 TTCAAATAGCAGGCTGGGCATGG - Intergenic
1098907406 12:76176318-76176340 TTAAAATAGAGGACTGGGCCGGG - Intergenic
1099039260 12:77630570-77630592 TTAAAAGACATGTACGGGCAAGG - Intergenic
1099144149 12:79017858-79017880 TTAGTATAGAAGTCATGGCATGG + Intronic
1100333465 12:93607535-93607557 TTAAAATTGAAGTCATTGCATGG + Intergenic
1100851649 12:98718520-98718542 ATAAAAAAGAAGGCCGGGCACGG - Intronic
1100912252 12:99378363-99378385 TTAAAAGAGAAGGCCGGGCATGG + Intronic
1101112009 12:101495427-101495449 TGAAAGTAGCAGGCCGGGCACGG - Intergenic
1101387417 12:104269999-104270021 TTAGAAGAGAAGGCCAGGCATGG - Intronic
1101859533 12:108471815-108471837 TTAAAATACAAATCAGGGCCAGG - Intergenic
1102074928 12:110052184-110052206 AAAAAAAAGAAGGCCGGGCACGG - Intronic
1102102653 12:110292557-110292579 TTAAATTAATAGGCCGGGCATGG - Intronic
1102151633 12:110692427-110692449 TTAAAGGAGAAGGCCGGGCATGG + Intronic
1102481233 12:113225039-113225061 GTAAAATAAAAGGCTGGGCACGG - Intronic
1102874807 12:116441305-116441327 TTAAAAAGGAAGTCAGGGCCAGG - Intergenic
1103384995 12:120525096-120525118 CAAAAACAAAAGTCCGGGCACGG - Intronic
1103395488 12:120603744-120603766 TTAAATTATTAGGCCGGGCACGG - Intergenic
1103577920 12:121892408-121892430 TCAAAATTAAAGGCCGGGCATGG + Intronic
1103691718 12:122780321-122780343 AAAAAAAAGAAGGCCGGGCATGG + Intronic
1103720600 12:122973272-122973294 TAAAAATACAAGGCCGGGCGCGG + Intronic
1104041927 12:125136338-125136360 ATAAAAAAGAGGGCCGGGCATGG - Intronic
1104055108 12:125224065-125224087 TTAAAACATTAGGCCGGGCACGG - Intronic
1104179391 12:126363688-126363710 TTAAAAATGAAGGCCAGGCACGG - Intergenic
1104832066 12:131759507-131759529 TGAAAATAGTAGGCCGGGCGCGG + Intronic
1105053203 12:133073654-133073676 TTAAAAATTAAGGCCGGGCATGG - Intergenic
1105241993 13:18616420-18616442 TAAATCTGGAAGTCCGGGCACGG - Intergenic
1105275153 13:18915551-18915573 ATAAAATAATAGGCCGGGCATGG + Intergenic
1105358337 13:19680925-19680947 TTAAAATACAAGGCCGGGCACGG + Intronic
1105420970 13:20251960-20251982 TTAAAGATGAAGGCCGGGCATGG - Intergenic
1105505707 13:21008052-21008074 TTAAAACAGAAGTCAGGGCTGGG - Intronic
1105521475 13:21135122-21135144 TTAAAAAAGAAGGCTGGGCACGG + Intergenic
1107362061 13:39629665-39629687 AATAAATAGAAGGCCGGGCATGG - Intergenic
1107763072 13:43702653-43702675 TTATAAAAGAAGTCTGGGCTGGG + Intronic
1107802779 13:44125979-44126001 TTATAATAGAAATACGTGCAGGG - Intergenic
1107882670 13:44846208-44846230 TTTAAACAAAAGGCCGGGCATGG - Intergenic
1107952295 13:45474450-45474472 GTAAAAAAGAAGGCCAGGCACGG - Intronic
1109206592 13:59489457-59489479 ATAATATATAAGGCCGGGCATGG - Intergenic
1109869192 13:68309566-68309588 TTACACAAGAAGTCCGGGCATGG - Intergenic
1110537841 13:76672660-76672682 TTAAAATAGATGTTCTGGCATGG + Intergenic
1110722094 13:78774071-78774093 TGATAATAGAAGTCTGGTCAAGG + Intergenic
1111530074 13:89525130-89525152 TTAAAAAACCAGGCCGGGCATGG - Intergenic
1112513810 13:100034268-100034290 ATAAAATACAAGACCGGGCACGG + Intergenic
1112977358 13:105336981-105337003 TTTAAAAAGAATTCCAGGCATGG - Intergenic
1113283736 13:108821695-108821717 TTCAAACAGATGTCCAGGCATGG + Intronic
1113315798 13:109177809-109177831 ATAAATTAGAAGTCGGGGCTGGG - Intronic
1113865857 13:113522918-113522940 CTAAAAAAGAAGGCCAGGCACGG - Intronic
1114285891 14:21242913-21242935 TTAAAAAAGCAGTGCCGGCATGG + Intronic
1114290203 14:21281802-21281824 AAAAAAAAGAAGTCTGGGCAGGG + Intergenic
1114445911 14:22787781-22787803 TTAAAATGTTAGGCCGGGCACGG + Intronic
1114670024 14:24405869-24405891 TTAAAATATCGGGCCGGGCACGG + Intronic
1115196914 14:30811390-30811412 TTAAAATATAGGGCCAGGCATGG - Intergenic
1115596490 14:34914898-34914920 TTAAAAAAGAAGTCTAGGCTGGG - Intergenic
1115675429 14:35668190-35668212 TTAAAATGTAAGGCTGGGCATGG + Intronic
1115683177 14:35764838-35764860 TTAAAATTTAAGGCCAGGCATGG - Intronic
1116294585 14:43090245-43090267 TTAAAATTTGAGGCCGGGCATGG - Intergenic
1116431648 14:44853105-44853127 TTTAAATAGAAGTGCTGGCTGGG + Intergenic
1116977804 14:51134978-51135000 TTAAAAAAAAAGGCCGGGCGCGG - Intergenic
1117686879 14:58262494-58262516 TTAAAAGGGAAGGCAGGGCAAGG - Intronic
1117724108 14:58655482-58655504 TCAAATTAAAAGACCGGGCATGG - Intergenic
1118591882 14:67407995-67408017 ATAAAATAGAGGGCCGGGCATGG + Intronic
1118969212 14:70618668-70618690 TAAAAATGGAAGTAGGGGCAGGG - Intergenic
1119292555 14:73507091-73507113 TAAAGACAGAAGGCCGGGCACGG - Intronic
1119333169 14:73810579-73810601 TTGAAATAGTAGTCAGGGCCAGG + Intergenic
1119388050 14:74270988-74271010 TTAAAATGCAAGTCCCGGCCAGG + Intergenic
1119874410 14:78045247-78045269 AAAAAATAAAAGGCCGGGCACGG + Intergenic
1119989145 14:79175273-79175295 TTAAAAAAGAAATCTGGGCTGGG - Intronic
1120774499 14:88418762-88418784 TGAAAATTGTAGGCCGGGCATGG - Intronic
1120789986 14:88571669-88571691 TAAAAATAGATGGCCGGGCACGG + Intronic
1122400602 14:101465147-101465169 TTAAAAGAGAAGCACAGGCAGGG + Intergenic
1123674952 15:22701439-22701461 TAAAAATAAAAGGCCGGGCATGG - Intergenic
1123767423 15:23495454-23495476 TAAAAATTGAAGGCCAGGCACGG + Intergenic
1124326967 15:28774429-28774451 TAAAAATAAAAGGCCGGGCATGG - Intergenic
1124646655 15:31441690-31441712 TAAAAATAAAGGGCCGGGCACGG - Intergenic
1124704279 15:31948806-31948828 ATAAAATAGTAGGCCGGGCGCGG - Intergenic
1124804258 15:32865539-32865561 TTAAAATAAAAGACCTGGCCGGG + Intronic
1125198055 15:37071354-37071376 TCCAACTAGAAGTCCGGGCTTGG + Intronic
1125529239 15:40401071-40401093 TTACAAAAGAAGGCCGGGCACGG - Intergenic
1125951825 15:43758683-43758705 TAAAAATAGAAGGCCAGGCACGG + Intronic
1126022485 15:44416398-44416420 TAAAAATAAAAGTCCTGGCTGGG + Intergenic
1126120042 15:45243264-45243286 TTGAAATAGAACTCTGGGCCAGG + Intergenic
1126157364 15:45577833-45577855 TGAAAATAGAAGTTTGGGCTGGG + Intergenic
1126632725 15:50754085-50754107 GAAAGAAAGAAGTCCGGGCATGG - Intronic
1126650896 15:50920401-50920423 AAAAAAAAGAAGGCCGGGCACGG - Intronic
1127223874 15:56910192-56910214 TGAAAATAGGAGGCTGGGCATGG + Intronic
1127383573 15:58449832-58449854 TTAAAACCCAAGGCCGGGCATGG - Intronic
1127392978 15:58521823-58521845 TTATATAAGAAGTCCAGGCATGG + Intronic
1127487486 15:59432843-59432865 TTAAAAAATCAGGCCGGGCATGG + Intronic
1127736448 15:61844358-61844380 TAAAAAGTGAAGGCCGGGCACGG - Intergenic
1127948482 15:63780429-63780451 GTAAAACAGAAGGCCGGGCGCGG + Intronic
1128391119 15:67183332-67183354 TTAAAAAAATAGGCCGGGCATGG - Intronic
1128611663 15:69078745-69078767 TAAAAAAAAAAATCCGGGCATGG - Intergenic
1128835887 15:70808743-70808765 TTATGATAGAGGGCCGGGCAAGG + Intergenic
1129406567 15:75323028-75323050 ATTAAATAAAAGGCCGGGCACGG - Intergenic
1129494322 15:75963487-75963509 TTAAAAAATTAGGCCGGGCATGG + Intronic
1129504930 15:76073219-76073241 AAAAAAAAGAAGGCCGGGCAAGG - Intronic
1129648843 15:77464967-77464989 TTAAAAAAGCTGGCCGGGCATGG + Intronic
1129816102 15:78555951-78555973 CTATTATAGAAGTCCAGGCAAGG - Intergenic
1130338408 15:82977854-82977876 TAAAACTGGAAGGCCGGGCACGG + Intronic
1130644278 15:85709981-85710003 TTAAAATGAAATTCCAGGCAGGG - Intronic
1131027739 15:89159084-89159106 TTACAATACAACGCCGGGCACGG + Intronic
1131261115 15:90888400-90888422 TTAAAACAGAGGTCAGGGCTGGG - Intronic
1132192463 15:99878861-99878883 TTAAAATTGAAGTTCAGGCTGGG - Intergenic
1132545671 16:531942-531964 TAAAAATAGAAGTCGGGGCTGGG + Intronic
1132690507 16:1180028-1180050 TTAAAAAACAAGGCCGGGCCGGG - Intronic
1134380342 16:13718474-13718496 TTAAAATCTCAGGCCGGGCACGG - Intergenic
1134481223 16:14621119-14621141 TTAAAAAAGAAGTGGGGGTAGGG - Intronic
1135343697 16:21669828-21669850 TTAAAATAAAAGTCAGGGCCAGG + Intergenic
1136254806 16:29030961-29030983 TAAACATAGTAGGCCGGGCACGG + Intergenic
1136281492 16:29214488-29214510 ATAAAATAGACGTCCGAACAAGG + Intergenic
1136404658 16:30037250-30037272 TTAGAATAATAGGCCGGGCACGG + Intronic
1136453087 16:30365334-30365356 TAAAAATAGAAGTCCAGGCCAGG - Intronic
1136520012 16:30789236-30789258 AAAAAAAAAAAGTCCGGGCAGGG + Intergenic
1137250788 16:46739129-46739151 TCAAAATAAGAGGCCGGGCACGG - Intronic
1137349160 16:47695748-47695770 TTAAAATCCAAATCTGGGCATGG - Intronic
1137640444 16:50024407-50024429 TTAAAATAGAGATCCTGGCCGGG - Exonic
1137824312 16:51477246-51477268 TTAAATTAGAAGGCCAGGCGTGG - Intergenic
1137953611 16:52806992-52807014 TTAAAAAAGATGGCCGTGCATGG - Intergenic
1138793869 16:59943562-59943584 TTTAAAAAGTAGTCAGGGCAGGG + Intergenic
1138845274 16:60557527-60557549 ATAAAATAGAAGTTCTGGGAAGG - Intergenic
1139536571 16:67578962-67578984 TAAAAATAAAAGGCCGGGCGTGG + Intronic
1139632888 16:68241176-68241198 ATAAAATAAAAGCCCGGGCATGG - Intergenic
1139669689 16:68484241-68484263 TAAAAATACAAAGCCGGGCATGG + Intergenic
1139773825 16:69300538-69300560 TTAAAATCTAAGGCCAGGCACGG - Intronic
1139920980 16:70460399-70460421 AAAAAAAAGAAGTCCAGGCACGG - Intronic
1140290572 16:73651545-73651567 TAAAAAGACAAGGCCGGGCACGG + Intergenic
1140860231 16:79011781-79011803 TTAAAAAAGGGGGCCGGGCATGG - Intronic
1141022582 16:80511341-80511363 TTAAAATACAATTCTGGGCCGGG - Intergenic
1141118893 16:81335454-81335476 TAAAAATACATGGCCGGGCATGG + Intronic
1141120953 16:81355656-81355678 TTAAAAATGAAGTCCTGGCTGGG - Intronic
1141199656 16:81887407-81887429 TTAAAATACTAGGCCGGGCGTGG - Intronic
1141407936 16:83809756-83809778 ATAAAAAAAAAGACCGGGCACGG - Intronic
1141897685 16:86969054-86969076 CTAAAACAGATGTCAGGGCAGGG + Intergenic
1142013633 16:87731365-87731387 TTAAGATAGAATTCTGGGCCGGG - Intronic
1142701343 17:1663420-1663442 TTAAATAAAAAGGCCGGGCATGG + Intronic
1142861429 17:2764430-2764452 TAAAAATAGAAGGCCAGGCGCGG + Intergenic
1142871563 17:2824450-2824472 AAAAAAAAAAAGTCCGGGCATGG + Intronic
1143001879 17:3799832-3799854 ATAAAATATTAGGCCGGGCAAGG + Intronic
1143222183 17:5271832-5271854 TTAAAAACTAAGGCCGGGCATGG - Intergenic
1143357780 17:6343405-6343427 TTAAAACAGAAGTCCAGGCCAGG + Intergenic
1143785419 17:9252012-9252034 TTAAAAAAATAGGCCGGGCACGG + Intronic
1143828240 17:9630281-9630303 TTAAAATGTAAGTCAGGGCCAGG + Intronic
1143878629 17:10012805-10012827 TTAAAAGAGAAACCCAGGCAGGG + Intronic
1143918761 17:10314257-10314279 TAAAAATACAAAACCGGGCATGG + Intronic
1144352813 17:14414856-14414878 GTAATATAGAAGGCCGGGCACGG + Intergenic
1144392493 17:14807805-14807827 TTAAATTAGAAATCAGGGCAAGG + Intergenic
1144545276 17:16189101-16189123 ATCAAATAGCAGGCCGGGCATGG + Intronic
1144746738 17:17621058-17621080 TTAAAATATTTGGCCGGGCACGG + Intergenic
1144801592 17:17932418-17932440 TTAAAAAAGAGGGCTGGGCACGG - Intronic
1146951363 17:36908822-36908844 TTAAAAGTGACGGCCGGGCACGG + Intergenic
1147005332 17:37398581-37398603 TCAAAAAAAAAGCCCGGGCATGG - Intronic
1147051599 17:37799232-37799254 TTGAAATACTTGTCCGGGCACGG + Intergenic
1147257205 17:39188750-39188772 TAATAATAGCAGGCCGGGCACGG + Intronic
1147589705 17:41674281-41674303 TTAAGAAACAAGGCCGGGCACGG - Intergenic
1147650782 17:42060698-42060720 TAAAAATAGAAGTCAGAGGAGGG - Intronic
1147750547 17:42729747-42729769 AAAAAAAAAAAGTCCGGGCATGG + Intronic
1147811618 17:43174304-43174326 TTTAAAAAATAGTCCGGGCATGG + Intronic
1148241651 17:46003072-46003094 TAAAAAGAGAAGGTCGGGCATGG - Intronic
1148385140 17:47229015-47229037 AAAAAAAAGAAGTCCGGGCGCGG + Intergenic
1148537470 17:48452262-48452284 ATAAGATAGAAGGCCAGGCATGG - Intergenic
1148597145 17:48865829-48865851 TAAAAAAAGGAGGCCGGGCACGG + Intronic
1148602736 17:48906809-48906831 TTAAAAAAGAAGTCTGGGCCGGG - Intergenic
1148660917 17:49331991-49332013 ATAAAATAAAAGGCTGGGCATGG + Intronic
1148746078 17:49919267-49919289 TTAAAAAAGAAATCCAGGCCAGG - Intergenic
1148923933 17:51065326-51065348 TTAAAATTGAAATCCAGGCTGGG - Intronic
1149878961 17:60268099-60268121 TTAAAATTGTTGGCCGGGCATGG - Intronic
1149986431 17:61350922-61350944 TTAAGATTGAAGGCTGGGCATGG - Intronic
1150260327 17:63784616-63784638 TTAAAATAAAAACCCAGGCATGG + Intronic
1150354846 17:64474363-64474385 ATAAAAAATAAGGCCGGGCACGG - Intergenic
1150691898 17:67374253-67374275 TAAAAAATGAAGGCCGGGCATGG - Intergenic
1150737693 17:67754420-67754442 TTAAAATAGAAGCCAGGGCCGGG + Intergenic
1151227341 17:72656851-72656873 TAAACATCGAAGGCCGGGCATGG + Intronic
1151762913 17:76116843-76116865 TAAAAATAGGAGGCCAGGCATGG - Intronic
1152417954 17:80175266-80175288 GAAAAATAGCAGGCCGGGCATGG - Intronic
1152648016 17:81479101-81479123 ATAAAATAAAAGGCCGGGCGCGG - Intergenic
1152773471 17:82185325-82185347 ATAAAAAAGAAGGCTGGGCATGG + Intronic
1153009118 18:521828-521850 TTGAAAAATAAGGCCGGGCATGG - Intergenic
1153034503 18:747571-747593 TTAAAAAATAAGTCAAGGCAGGG + Intronic
1153350135 18:4070650-4070672 ATAAAATAGAATTCATGGCAAGG + Intronic
1153393536 18:4591364-4591386 TAAAAATAACAGGCCGGGCATGG + Intergenic
1154181789 18:12144846-12144868 TTAAAAAAGCAGTCTGGGCTGGG + Intergenic
1154182114 18:12146738-12146760 TTAAAAAAGCAGTCTGGGCTGGG - Intergenic
1154235867 18:12605226-12605248 TTAAAATAAAAGGCTGGGCATGG + Intronic
1154446957 18:14443458-14443480 TAAATCTGGAAGTCCGGGCACGG + Intergenic
1154466777 18:14652678-14652700 ATAAAATAATAGGCCGGGCACGG + Intergenic
1155167345 18:23241978-23242000 TTAAAAAAAAATTCCGGGCCAGG + Intronic
1155170675 18:23264933-23264955 TTAAAAGTGTAGGCCGGGCACGG - Intronic
1155417505 18:25614881-25614903 TTAAAATATAATTCCAGGGAGGG - Intergenic
1155599926 18:27533544-27533566 TTAAGGTATAAGGCCGGGCACGG - Intergenic
1155669823 18:28356606-28356628 GGAAAAAAGTAGTCCGGGCACGG - Intergenic
1156010685 18:32494117-32494139 TTAAAATAGAATTCTGGGATTGG + Intergenic
1156552491 18:38032441-38032463 TCAAGATAGAAGTCAGAGCAAGG - Intergenic
1157848268 18:51024273-51024295 TTAAAATAGAAGTCAGGGCCAGG - Intronic
1158385937 18:56991433-56991455 TTAAAAAATGAGGCCGGGCATGG - Intronic
1159314076 18:66748559-66748581 TAAAAATTAAAGGCCGGGCACGG + Intergenic
1159498253 18:69234191-69234213 TTAAAATATATGGCCAGGCATGG + Intergenic
1159701645 18:71636854-71636876 TTAAAATTGAAGGCCGGGCGCGG + Intergenic
1160748293 19:721554-721576 TAAAAAAAGAAGGCCAGGCACGG - Intronic
1160802887 19:978567-978589 TAATAATAAAAGGCCGGGCACGG + Intergenic
1160937113 19:1601864-1601886 TTAAAATCCAATTCCGGGCGGGG + Intronic
1161147846 19:2690089-2690111 TTAAAAATGGAGGCCGGGCACGG + Intronic
1161161825 19:2765926-2765948 TAAAAATATAAGCCCGGGCGCGG + Intronic
1161194635 19:2979535-2979557 TAAAAATAAAAGTCCGGGCAAGG - Intronic
1161413126 19:4128199-4128221 TAAAAATACAAGGCCGGGCGCGG + Intergenic
1161460299 19:4392650-4392672 TTAAAAAAGAGGTCAGGGCCGGG + Intronic
1161465069 19:4424923-4424945 TTAAAAAATTAGGCCGGGCACGG - Intronic
1161500952 19:4615370-4615392 TTAAAATCTAAGTCAGGGCCAGG + Intergenic
1161720931 19:5902253-5902275 TAAAAATAATAGGCCGGGCATGG - Intronic
1161749632 19:6085794-6085816 ATAAAATAAAAGTCCTGGCTGGG + Intronic
1161787240 19:6334336-6334358 TTAAAAAAAAAGGCCGGGCACGG - Intergenic
1161834542 19:6636772-6636794 TTAAAAAGTAAGGCCGGGCACGG - Intergenic
1161971636 19:7584625-7584647 TGAAAATAAAAGGCCGGGCGCGG - Intergenic
1161997143 19:7720130-7720152 TAAAAATAAAAGGCTGGGCATGG - Intergenic
1162125299 19:8496432-8496454 TAAAAATATAAGGCCGGGCGCGG + Intronic
1162508372 19:11101793-11101815 TTAAAATGGGAGACCAGGCATGG + Intronic
1162546607 19:11334632-11334654 TTAAAAAAAAAGGCCAGGCATGG + Intronic
1162880841 19:13658046-13658068 ATAAAATTTAAGTCTGGGCACGG + Intergenic
1163006560 19:14400499-14400521 TTAAGATTGCAGGCCGGGCATGG + Intronic
1163167032 19:15505676-15505698 ATAAAATAAAAGGCCAGGCACGG + Intergenic
1163247391 19:16105366-16105388 ATAAAATAACAGGCCGGGCACGG + Intergenic
1163482597 19:17566821-17566843 GTAAAATAGTAGGCCAGGCATGG + Intronic
1163616928 19:18334842-18334864 ATAAAATAAATGGCCGGGCACGG - Intergenic
1163673297 19:18641914-18641936 TTAAGAAAGAGGGCCGGGCATGG - Intronic
1163841180 19:19611388-19611410 TAAAAAGAGAAGGCCGGGCATGG + Intronic
1163917262 19:20252002-20252024 TTAAAATAGAAGCACTGGCCAGG + Intergenic
1164705851 19:30319115-30319137 TTAAAATAGAAGTCCGGGCATGG + Intronic
1164774206 19:30839186-30839208 TTAAAATAGAAATCCTGGTCAGG + Intergenic
1165886356 19:39081838-39081860 TAAAAATACAAGGCCGGGCGCGG + Intergenic
1166274646 19:41744373-41744395 TAAAAATAGAAGGCAGGGCCAGG + Intronic
1166823457 19:45594984-45595006 AAAAAAAAGAAGTCCAGGCACGG + Intronic
1166830678 19:45637965-45637987 ATAAAATAGCAGGCCGGGCGCGG - Intronic
1167005085 19:46770754-46770776 TTAAAATAAAAGCCGGGGCTGGG - Intronic
1167038351 19:47007632-47007654 AAAAAAAAAAAGTCCGGGCATGG - Intergenic
1167489589 19:49784135-49784157 ATAAAACAGAAGGCCGGGCGTGG + Intronic
1167536554 19:50056870-50056892 TAAAAATATATGGCCGGGCACGG + Intergenic
1167857332 19:52253290-52253312 TTAAAATAGAAATCATGGCTAGG - Intergenic
1168563197 19:57400726-57400748 TAAAAATAGAAATCCTGGCCAGG - Intronic
925036164 2:687827-687849 TCAAAATAGAGGTCCTGGGAGGG + Intergenic
925864772 2:8217827-8217849 TTAAAATAGAAGTGGGGGCAGGG - Intergenic
926014905 2:9442553-9442575 TTAAAATAGATTTCCAGGCTGGG + Intronic
926738126 2:16089867-16089889 TTAAAATAGAAGGCCGGGCATGG - Intergenic
926794409 2:16607187-16607209 TTAAAATAAAAGCCCTGGCTTGG + Intronic
927736478 2:25527231-25527253 TTAGAAAAGGAGTCTGGGCACGG + Intronic
927769322 2:25844925-25844947 TTACAATAGCAGGCCAGGCATGG - Intronic
927977626 2:27351119-27351141 AAAAAATAGCAGGCCGGGCATGG + Intronic
928099576 2:28428293-28428315 TTAAAATAAAAGTCTCGGCCGGG + Intergenic
929250389 2:39748410-39748432 TTTAAAAAGAAGGCCGGGTACGG + Intronic
929999593 2:46851771-46851793 TTAAAACAGAAGCCCTGGCCAGG - Intronic
930582776 2:53232299-53232321 TTAAAATAGGAGTTGGGTCACGG - Intergenic
930745693 2:54881362-54881384 TAAAAACAGGAGGCCGGGCATGG + Intronic
930856880 2:56028428-56028450 TTAAAAAAGCTGGCCGGGCACGG - Intergenic
930866738 2:56129359-56129381 TTTAAAAACAAGGCCGGGCATGG - Intergenic
931309859 2:61067389-61067411 CTAAAATGGAATTCAGGGCAAGG - Intronic
931334150 2:61321936-61321958 TGAAAAAAGGAGGCCGGGCACGG + Intronic
931873844 2:66490723-66490745 GTAAAATAAAAGCCCTGGCAAGG + Intronic
932157055 2:69427389-69427411 AAAAAATAGAAGGCCAGGCATGG + Intronic
932204392 2:69865923-69865945 ATTAAATAGAAGGCTGGGCATGG - Intronic
932717722 2:74114559-74114581 TTAAAAAAGCAGGCTGGGCATGG + Intergenic
932802715 2:74756094-74756116 GTAAAAAAGAAGTCTGGGCTCGG + Intergenic
932815645 2:74859394-74859416 AATAAATAGAAGGCCGGGCATGG + Intronic
933149205 2:78893889-78893911 TTAAAAAAGAAATCCTGGCTGGG + Intergenic
933829329 2:86194273-86194295 GTAGGATAGAAGTCTGGGCACGG - Intronic
933836225 2:86247864-86247886 TATAAATAGAAGTCCTGGCCAGG - Intronic
933913429 2:86964332-86964354 TAAAAAAAAAAGTCCGGGAATGG - Intronic
934009565 2:87805566-87805588 TAAAAAAAAAAGTCCGGGAATGG + Intronic
934013953 2:87857641-87857663 TTAAAATAGTAGTCGAGGCTAGG + Intergenic
934096850 2:88614700-88614722 TTAAGAAAGAAGTGAGGGCATGG - Intronic
934575980 2:95401912-95401934 CTCAAATAGAAGTCGGGACATGG + Intergenic
934638151 2:96009769-96009791 CTCAAATAGAAGTCGGGCCATGG + Intergenic
934737394 2:96696582-96696604 TTAAGATTTAAGGCCGGGCATGG - Intergenic
934795500 2:97095641-97095663 CTCAAATAGAAGTCGGGCCATGG - Intergenic
935146087 2:100396476-100396498 TTAAGATTGGAGTCCTGGCAGGG + Intronic
935242815 2:101192984-101193006 ATAAATCAGAAGGCCGGGCATGG - Intronic
935688239 2:105705836-105705858 TAAAAAAATAAGGCCGGGCATGG + Intergenic
937187779 2:120061511-120061533 TTAAAAAAAAAGGCCGGGCGCGG - Intronic
937416061 2:121715500-121715522 GTTGATTAGAAGTCCGGGCACGG + Intergenic
937918079 2:127108996-127109018 ATAAAAAACAAGGCCGGGCACGG - Intergenic
938174703 2:129114820-129114842 TACAAATAGAAGGCCGGGAAAGG + Intergenic
938210582 2:129463244-129463266 TAAGAATAGAATTCTGGGCATGG + Intergenic
939442584 2:142268933-142268955 TTACACTAGAAGTCCTGGAAAGG - Intergenic
939879484 2:147613669-147613691 TTTAAATTAAAGTCCAGGCATGG - Intergenic
940211093 2:151257399-151257421 TTTAAAAAGAAGGCCAGGCACGG + Intronic
942036563 2:172015964-172015986 TAAAAATAGAGAGCCGGGCATGG + Intronic
942554260 2:177155382-177155404 TAAAAATAAAAATACGGGCATGG + Intergenic
942878278 2:180828481-180828503 TTAAAATAATAAGCCGGGCACGG - Intergenic
943770262 2:191708902-191708924 TTAACTCAGAAGTCCAGGCATGG - Intergenic
943770297 2:191709278-191709300 TTAAAAAAGAAGTCTGGGTCGGG + Intergenic
944269309 2:197763190-197763212 TTAAGAAACAAGGCCGGGCACGG + Intronic
944302549 2:198140146-198140168 TTAAAAAAGAAGTATGGGCCAGG - Intronic
944823590 2:203457472-203457494 TTAAAATATTAGGCCAGGCATGG - Intronic
945070884 2:205987863-205987885 TGAAAATATAAGGCCGGGCATGG - Intergenic
945456073 2:210054024-210054046 TGAAACTAGACGGCCGGGCATGG + Intronic
945621591 2:212146284-212146306 AGAAAATAGAAGTCCCAGCAAGG - Intronic
945905311 2:215586383-215586405 ATAAAATAGGAGTGCGGGCAAGG + Intergenic
946652082 2:221903503-221903525 TTAACAAATAAGGCCGGGCATGG + Intergenic
946739997 2:222791916-222791938 TTAAAATAGAAGTATGGACGAGG - Intergenic
946909725 2:224447601-224447623 TAAAAAAAGAAGGCCGGGCGCGG - Intergenic
946911447 2:224465242-224465264 TTAAAATTGTTGGCCGGGCAAGG - Intergenic
947027771 2:225758195-225758217 AAAAAAAAGAAGGCCGGGCATGG + Intergenic
947254150 2:228143244-228143266 TTAAAATATAAGACTGGGCCAGG + Intronic
948442661 2:238005484-238005506 TAAAAAAATAAGGCCGGGCATGG - Intronic
948503693 2:238413091-238413113 TTAAGATGGTAGTCCAGGCAGGG - Intergenic
948987033 2:241532136-241532158 TTAACATACAGGGCCGGGCATGG - Intergenic
1168898550 20:1340733-1340755 TTGAAAGAGAAGGCTGGGCATGG - Intronic
1168923004 20:1556803-1556825 TCAAAATCGAAGTGTGGGCAGGG - Intronic
1169097113 20:2911950-2911972 AGAAATTAGAAGGCCGGGCATGG + Intronic
1169180841 20:3565475-3565497 TGAAAATAAAGGGCCGGGCACGG + Intronic
1169441006 20:5633872-5633894 TTAAAATGGAAGTGACGGCAGGG + Intergenic
1169979266 20:11365069-11365091 TGAAAATAGAAGGCTTGGCAAGG - Intergenic
1170003411 20:11640024-11640046 ATAAAAAAGAAGGCTGGGCACGG + Intergenic
1170192832 20:13660765-13660787 TTTAAATAGGAGTCTGGGCTGGG + Intergenic
1170498622 20:16951456-16951478 TCAAAATGGAAGGCCAGGCACGG + Intergenic
1171281826 20:23907126-23907148 TAAAAATAGAAGTCAGCACAAGG - Intergenic
1171382406 20:24743516-24743538 TTAAATTAGAATTGGGGGCAGGG + Intergenic
1171868316 20:30506600-30506622 TTAAAAATGAAGGCCGGGCGCGG + Intergenic
1172124134 20:32615061-32615083 GTAAAATAAAAGTCCAGGCTGGG - Intergenic
1172312151 20:33927056-33927078 TAAAAAAAAAAGGCCGGGCACGG + Intergenic
1172419964 20:34807813-34807835 CTAAAAAAAAAGGCCGGGCACGG - Intronic
1172440018 20:34958752-34958774 AGAAAATACAAGGCCGGGCACGG - Intergenic
1172538604 20:35693671-35693693 TTAAAATAACAGGCCGGGCGCGG + Intronic
1172543033 20:35736944-35736966 TTAAAAAAAAAGTCTGGGCTTGG - Intronic
1172616954 20:36295013-36295035 TAAAAATAGGAAGCCGGGCATGG + Intergenic
1172706190 20:36883796-36883818 TTAAAAGGGAAGCCAGGGCAGGG + Intronic
1172985465 20:38984203-38984225 TTAAAACAGAAGACCTGGCCAGG - Intronic
1173295772 20:41755105-41755127 TAAAAAGATAAGGCCGGGCATGG - Intergenic
1173815330 20:45984083-45984105 TAAAAATTAAAGGCCGGGCACGG - Intergenic
1173963168 20:47090528-47090550 AAAAAAAAAAAGTCCGGGCATGG - Intronic
1174418841 20:50386052-50386074 TAAAAATCAAAGTCAGGGCAGGG - Intergenic
1174641701 20:52050035-52050057 TTAAAAGAGGAGGCCGGGCATGG - Intergenic
1174706162 20:52658277-52658299 TTAAAATATAAATCTGGGCTAGG - Intergenic
1175117897 20:56695939-56695961 TTAAAATTTAAGTCCGGGCGCGG - Intergenic
1176551736 21:8225911-8225933 TTAAAAATGAAGGCCGGGCGCGG - Intergenic
1176570645 21:8408910-8408932 TTAAAAATGAAGGCCGGGCGCGG - Intergenic
1176578554 21:8453077-8453099 TTAAAAATGAAGGCCGGGCGCGG - Intergenic
1177144451 21:17392536-17392558 TTAAAATACAAAGCCAGGCATGG + Intergenic
1177336224 21:19732007-19732029 AGAAAAAAGAAGGCCGGGCATGG - Intergenic
1177356269 21:20012270-20012292 TGAAAATTGTAGGCCGGGCACGG + Intergenic
1177808843 21:25903075-25903097 TTAAAAGAATAGGCCGGGCATGG + Intronic
1178274891 21:31228199-31228221 TAAAAAAAGGAGGCCGGGCATGG - Intronic
1178335840 21:31742351-31742373 GTAAAAGAGAATTCAGGGCAAGG - Intergenic
1179664608 21:42901916-42901938 TAAAAATAAAATGCCGGGCACGG + Intronic
1179669751 21:42938360-42938382 TAAAAATAAAAGTCTTGGCAAGG - Intergenic
1180627363 22:17203062-17203084 ATGAAATAGACGGCCGGGCATGG - Intronic
1180705848 22:17809343-17809365 TTAAAACAGAAGGCCAGGCACGG + Intronic
1181292795 22:21810377-21810399 TTAAAAAAGAAGGCCGGGTGCGG + Intronic
1181305033 22:21911380-21911402 TTAAAAGATAAGTCAGGGCCAGG + Intergenic
1181862483 22:25829547-25829569 TTGAAATATAAGGCCAGGCACGG + Intronic
1181907482 22:26210843-26210865 TTAAAATAGAAGACTTTGCATGG + Intronic
1182633109 22:31702804-31702826 AAAAAATAAAAGGCCGGGCACGG - Intronic
1182843656 22:33412949-33412971 TTAAAAATCAAGGCCGGGCACGG - Intronic
1182939049 22:34255881-34255903 TAATAATAGAAGTTGGGGCAGGG - Intergenic
1183886287 22:40885692-40885714 TTAATAATGAAGGCCGGGCATGG + Intronic
1184004621 22:41699203-41699225 TTAAAAATGAAGGCCGGGCATGG - Intergenic
1184055928 22:42049398-42049420 ATAACATAGGAGGCCGGGCACGG + Intronic
1184492378 22:44817175-44817197 TAAGAAAAGAAGGCCGGGCATGG - Intronic
1185121790 22:48975647-48975669 TCAAAAGAGGAGTCCGGGCCTGG - Intergenic
1203256755 22_KI270733v1_random:142831-142853 TTAAAAATGAAGGCCGGGCGCGG - Intergenic
949679300 3:6494615-6494637 TTAAAATACAAAGCTGGGCATGG - Intergenic
949780119 3:7676969-7676991 TTAAAAAATAAGGCTGGGCATGG + Intronic
949797655 3:7868271-7868293 TTAAAATTCCAGGCCGGGCACGG - Intergenic
950035359 3:9881084-9881106 AAAAAAAAAAAGTCCGGGCACGG + Intergenic
950936468 3:16844245-16844267 TAAAAATAGAGGTCTTGGCAGGG + Intronic
951498604 3:23358126-23358148 TTAAAATAGATTTCTGGGCCAGG - Intronic
951823729 3:26843650-26843672 TAAAAGTAGAAGGCCGGGCGCGG - Intergenic
952313377 3:32210571-32210593 TTTAAAAAGAAGTCCAGGCTGGG - Intergenic
952480963 3:33761255-33761277 ATAAAACAAAAGGCCGGGCACGG - Intergenic
952811309 3:37406117-37406139 TTGGAAAAGAAGGCCGGGCATGG - Intronic
952824336 3:37512500-37512522 TAAAAGAAGAAGGCCGGGCATGG - Intronic
953671706 3:44968405-44968427 TTTAAAAACAAGTCTGGGCATGG + Intronic
954063189 3:48086344-48086366 TAAAAATAAATGGCCGGGCATGG + Intronic
954268257 3:49487178-49487200 TTAAAACATCAGGCCGGGCACGG - Intronic
954346326 3:50002685-50002707 TTATAATTGAAGGCCAGGCACGG - Intronic
954365369 3:50143251-50143273 AAAAAAAAGAAGTCCGGGCACGG - Intergenic
954612424 3:51952838-51952860 AAAAAAAAGAAGGCCGGGCATGG + Intergenic
954738741 3:52729416-52729438 TTAAAAAAAAAGGGCGGGCACGG + Intronic
954789004 3:53116891-53116913 TTTAAAAAGAAGCCCGGGCATGG - Intronic
954801762 3:53191113-53191135 TTAAAATATAAGTTCAGGCCGGG + Intronic
955259142 3:57367030-57367052 TTAAAATAGAAAACAGGGCCAGG + Intronic
956077360 3:65519677-65519699 TTAAAATCTAAGTCAGGGCCAGG - Intronic
956403020 3:68899947-68899969 TTAAAATAATAGGCCTGGCATGG + Intronic
956444628 3:69313847-69313869 TTAAAAAAAAAGGCCGGGCGCGG + Intronic
956853215 3:73251576-73251598 TAAAAATAGAAGTCAGTACAGGG - Intergenic
957361446 3:79164626-79164648 TTAAAATAGAATTCAGGTCCTGG + Intronic
957806198 3:85152665-85152687 TTAAAATGTAAGGCTGGGCACGG + Intronic
958504880 3:94962683-94962705 TTAAAATAGAAGTTGAGGAATGG + Intergenic
959463502 3:106655456-106655478 GAAAATTAGAAGTCCGGGCGCGG - Intergenic
959695132 3:109241117-109241139 AGAAAAAAGAAGGCCGGGCATGG + Intergenic
959832844 3:110884750-110884772 TCAAAAAAAAAGGCCGGGCACGG + Intergenic
960217866 3:115064741-115064763 TTCAGAGAGAAGGCCGGGCACGG - Intronic
960799860 3:121527350-121527372 TTAAAAAATTAGGCCGGGCATGG - Intronic
961696229 3:128707138-128707160 TCAAAAAAAAAGGCCGGGCACGG + Intergenic
961763245 3:129187309-129187331 AAAAAAAAAAAGTCCGGGCACGG + Intergenic
962537692 3:136344902-136344924 TTAAAAGAGAAGCCTGGGCGTGG - Intronic
962566979 3:136670760-136670782 AGAAAAAACAAGTCCGGGCATGG - Intronic
963125051 3:141808422-141808444 AGAAAGTAGAAGGCCGGGCAGGG + Intronic
963159289 3:142133898-142133920 TTAAAATTGAGGGCAGGGCACGG + Intronic
963734389 3:149003404-149003426 ATAAAGTAAAAGTCCAGGCACGG - Intronic
963802580 3:149691724-149691746 TTTAAAAAGAAGGCCGGGCGCGG + Intronic
964011278 3:151894946-151894968 TTAAAAAAAAAGGCCGTGCACGG + Intergenic
964069001 3:152609573-152609595 TTAAAATAAAAGTTCAGGCTGGG + Intergenic
964283088 3:155088391-155088413 TGAAAAGAGAAGGCTGGGCACGG + Intronic
965388000 3:168069121-168069143 TTAAAAGTGCAGGCCGGGCATGG - Intronic
965544896 3:169905193-169905215 TTAAAAAAGATGGCCGGGCACGG + Intergenic
965616701 3:170601174-170601196 TTAACATAGTGGGCCGGGCATGG - Intronic
965814012 3:172618387-172618409 TTAAAAAATTAGGCCGGGCATGG + Intergenic
966444644 3:179988107-179988129 TTAAAAAAGAGGGCTGGGCATGG + Intronic
967007199 3:185395646-185395668 ATAATATTGAAGGCCGGGCACGG - Intronic
967518953 3:190405266-190405288 TAAAAATACAAATCCAGGCATGG + Intronic
967657318 3:192066410-192066432 TTGAAAGAGAGGGCCGGGCACGG + Intergenic
968158725 3:196406321-196406343 TTAAAAAAAAAGTCCAGGCATGG - Intronic
968636020 4:1680028-1680050 AAAAAAAAAAAGTCCGGGCACGG + Intronic
969424298 4:7115167-7115189 TTATAAAATAAGGCCGGGCATGG - Intergenic
970138068 4:12948156-12948178 TAAAACTAGGAGGCCGGGCACGG + Intergenic
970295667 4:14626810-14626832 TTAATAAAGTAGGCCGGGCATGG - Intergenic
970334895 4:15026515-15026537 TTAAAAAAATAGTTCGGGCATGG - Intronic
971979688 4:33736026-33736048 TTGAAATAGAGGTCAGGGCCAGG + Intergenic
972353926 4:38262831-38262853 TTAAAATAATAGGCCAGGCACGG - Intergenic
972575883 4:40351045-40351067 TTAAAAATGAAGGCCGGGCTTGG + Intronic
973182656 4:47288555-47288577 TTAAGATAGAAGCCCTGGCTGGG - Intronic
973664506 4:53144154-53144176 TCAAAATATAAGGCTGGGCATGG + Intronic
973768234 4:54183171-54183193 TTAAAAAAAAAGTCTGGGCACGG - Intronic
975578816 4:75888914-75888936 TTAAAAAACAAGTCAGGGCTGGG + Intronic
975863265 4:78700514-78700536 TTCAAAAAGATGGCCGGGCAAGG + Intergenic
976193219 4:82508759-82508781 ATAAAAAAGAAGTACGGGCCAGG - Intronic
976288794 4:83396481-83396503 TTAAAATAGAGATTTGGGCAAGG - Intergenic
976461606 4:85319280-85319302 TTAAAATTGAACTCAGGGGAAGG - Intergenic
976724246 4:88200032-88200054 TTTAAATAGAAGGCCCGGCATGG + Intronic
976729842 4:88250721-88250743 TAAAAATACAAGGCTGGGCACGG - Intergenic
976763096 4:88571046-88571068 GTAAAATAGGAGGCCGGGCACGG - Intronic
977602100 4:98944534-98944556 AAAAAAAAGAAGGCCGGGCATGG - Intergenic
978133531 4:105229597-105229619 ATAAAATAAAAGGCCAGGCACGG - Intronic
978436953 4:108695739-108695761 TTAAAATATAAGTCAAGGCCAGG - Intergenic
978507947 4:109480767-109480789 TTGAAAATGAAGGCCGGGCATGG - Intronic
979053775 4:115970646-115970668 TTAAAAAATAAGGCTGGGCATGG - Intergenic
979595213 4:122527257-122527279 TATAGATAGAAGGCCGGGCACGG + Intergenic
979661080 4:123255808-123255830 TGAAAATAGAAGGCTGGGCGCGG - Intronic
980109021 4:128617120-128617142 AAAAAATACAAGGCCGGGCATGG + Intergenic
980143778 4:128954601-128954623 TTAAAAGAGCTGGCCGGGCACGG - Intronic
980467050 4:133200086-133200108 TAAAAATAAAAGGCCGGGCGCGG - Intronic
981261600 4:142727583-142727605 TTAAAAAATAAGTCAGGGCTGGG + Intronic
981521310 4:145665524-145665546 TGAAAAAAAAAGGCCGGGCACGG - Intergenic
981724385 4:147832356-147832378 TAAAAAGAGGAGTCCAGGCACGG + Intronic
981813726 4:148804900-148804922 TTAAAATATTAGGCTGGGCATGG - Intergenic
982678687 4:158404884-158404906 TTAAAATCAAAGTGCTGGCAGGG + Intronic
983201781 4:164868676-164868698 TTAAAAATGAAGTCCAGGCCAGG - Intergenic
983249342 4:165327283-165327305 TTGAAATAAAAGTCCTGGGACGG + Intergenic
983621971 4:169771577-169771599 TTAAAAAATATGGCCGGGCACGG - Intergenic
984010414 4:174364468-174364490 TAAAAATAGTGGGCCGGGCATGG + Intergenic
984372950 4:178890088-178890110 ATAAAATTGAAGGCCGGGCGCGG + Intergenic
984497197 4:180513693-180513715 CTAAAATGGAAATCCCGGCAAGG + Intergenic
984503646 4:180590033-180590055 TTAAAAAATAAGGCCGGGCATGG + Intergenic
984655866 4:182317596-182317618 TTAAAACACAAGGCCAGGCATGG - Intronic
985038150 4:185861890-185861912 ATAAAATAGAAGTCAGGGCTGGG - Intronic
985782660 5:1879279-1879301 TAAAAATAGTAGGCCGGGCGCGG - Intronic
986000358 5:3626408-3626430 TTAGAATGGAAGGCCAGGCATGG - Intergenic
986823096 5:11490830-11490852 TAAAAGTAGAAGGCCTGGCATGG + Intronic
987320755 5:16767013-16767035 TGAAAGTAGTAGGCCGGGCATGG - Intronic
987417929 5:17683523-17683545 TGAAAATAAGAGGCCGGGCACGG - Intergenic
988170929 5:27654332-27654354 TTAAAATATATGGCAGGGCACGG + Intergenic
988601086 5:32640053-32640075 TTAAAAAACAAGTCTGGACATGG - Intergenic
989599718 5:43189942-43189964 TTAAACTGAAAGGCCGGGCACGG - Intronic
989603045 5:43218000-43218022 GAAAAATAGAGGTCTGGGCACGG - Intronic
989630046 5:43472847-43472869 AAAAAACAGAAGGCCGGGCACGG + Intronic
990126123 5:52519547-52519569 CAAAAATAGAAGGCTGGGCATGG + Intergenic
990568809 5:57057031-57057053 TTAAAACAGAGGTCTGGGCCGGG + Intergenic
991325572 5:65427936-65427958 TTAATAAAGAAGGCCAGGCACGG + Intronic
991673028 5:69065971-69065993 TAAAAATAGGAGGCCGGGCGTGG - Intergenic
991770635 5:70037663-70037685 ATAAAAAACAAGGCCGGGCATGG + Intronic
991849929 5:70913081-70913103 ATAAAAAACAAGGCCGGGCATGG + Intronic
992395835 5:76368878-76368900 AGAAAATAGAAGTCCTGGCTGGG - Intergenic
993128639 5:83867953-83867975 TTAGAAAAGAAGGCTGGGCATGG + Intergenic
993219466 5:85072352-85072374 TTAAAATAGAAGTCCGCAGAGGG + Intergenic
994767940 5:103944045-103944067 TTAAAATACAAGGCTGGTCAAGG + Intergenic
994816030 5:104589771-104589793 TTAAAGTGAAAGTCCTGGCAAGG + Intergenic
996932673 5:128908946-128908968 ATAAATTAGAAGTTCAGGCAAGG - Intronic
996953555 5:129156838-129156860 TTAAAGAAGAAGTCTGGGCATGG - Intergenic
997547679 5:134722861-134722883 TTAAAATTCAAGACCAGGCATGG + Intronic
997561833 5:134852873-134852895 TTAAAAATACAGTCCGGGCACGG + Intronic
997945427 5:138196578-138196600 TCAAAAAAAAAGGCCGGGCACGG - Intronic
998274975 5:140743846-140743868 TAAAAATAGAATTACCGGCAGGG - Intergenic
998790308 5:145759294-145759316 TTAAGATAAAAATCAGGGCAGGG - Exonic
999273578 5:150313351-150313373 AGAAAACAGAAGTCCAGGCATGG - Intronic
999339099 5:150753153-150753175 CTAAAAGATAAGGCCGGGCACGG - Intronic
999415992 5:151396389-151396411 TAATAAGAGAAGGCCGGGCATGG - Intergenic
999587171 5:153102927-153102949 TAAAAATAGAAGGCTGGGTATGG + Intergenic
999894225 5:156011731-156011753 TAAAAATAGAATTCTGGGCCAGG - Intronic
1000333692 5:160225881-160225903 AGAAAATATAAGGCCGGGCAGGG + Intronic
1001520590 5:172389342-172389364 TAAAAATGCAAGGCCGGGCATGG - Intronic
1001616088 5:173044835-173044857 TCAAAATGGAGGGCCGGGCACGG - Intergenic
1001951381 5:175818956-175818978 TGAAATTAGAAGTCGGGGCCGGG - Intronic
1002273473 5:178088149-178088171 AAAAAAAAGAAGGCCGGGCACGG - Intergenic
1002488120 5:179553491-179553513 TTAAAAAACTAGGCCGGGCATGG + Intronic
1002619577 5:180478210-180478232 TTAATTTAGTAGGCCGGGCAAGG + Intergenic
1002718055 5:181240966-181240988 TAAAAATACAAAACCGGGCATGG + Intronic
1003104568 6:3205517-3205539 TCAAAAAAAAAGGCCGGGCACGG - Intergenic
1003224913 6:4194868-4194890 TTTAAGTAGAAGGCCGGGCATGG + Intergenic
1004074634 6:12333776-12333798 TTATAATACAGGGCCGGGCACGG + Intergenic
1005297716 6:24442869-24442891 ATAAAATAGAAGGTCAGGCATGG - Intronic
1005895959 6:30178681-30178703 TTAAGATAGAAGGCCAGGCATGG - Intergenic
1005941976 6:30567365-30567387 TAAAAATAGAAGGCCAGGCCAGG + Intergenic
1006754617 6:36404610-36404632 CTAAAATAACAGTCCGGGCACGG - Intronic
1007029249 6:38613329-38613351 TTAAAATCTCAGGCCGGGCATGG + Intronic
1007535813 6:42587646-42587668 TAAAAAAAGAAGTCTGGGCTTGG - Intronic
1007669539 6:43539957-43539979 TAAAAATAGAAGACGGGGCTGGG + Intronic
1007884536 6:45211553-45211575 TTAAAAGAGAATTCTGGGCCAGG + Intronic
1008373702 6:50766956-50766978 TTAAGAAAGCAGGCCGGGCACGG - Intronic
1009808488 6:68633130-68633152 TTCAAGTAGAAGTCAGGGCAGGG - Intergenic
1009916134 6:69999211-69999233 TTAAAAAAGAAGGCCGGGCATGG - Intronic
1010387226 6:75294993-75295015 TTAAAAAATAAGACTGGGCATGG - Intronic
1010763017 6:79746294-79746316 AGAAAAAAGAAGGCCGGGCATGG - Intergenic
1010806694 6:80245783-80245805 ATAAAAGAGAGGGCCGGGCACGG + Intronic
1011013370 6:82726986-82727008 TTAAAATATAAGTCAGGGTCGGG - Intergenic
1011345217 6:86362022-86362044 ATAAAATGGCAGTCTGGGCATGG + Intergenic
1011706024 6:90002478-90002500 ACAAAATAGAAGGCCGGGCATGG + Intronic
1012539265 6:100342052-100342074 ATAAGTTAGAAGTCCAGGCATGG + Intergenic
1013034063 6:106362953-106362975 TTAAAATAGGAGGCCGGGCGCGG + Intergenic
1013065661 6:106682614-106682636 TTAAAATTGTAGGCCGGTCACGG - Intergenic
1013103426 6:107006648-107006670 TTCAAAAAGAAGGCCAGGCATGG + Intergenic
1013481071 6:110553267-110553289 TTAAAAAAAAAGGCCGGGCACGG - Intergenic
1013758313 6:113486371-113486393 TCAAAATACCACTCCGGGCATGG - Intergenic
1014105041 6:117551837-117551859 TTAAAATATCAGGCCAGGCACGG + Intronic
1014470798 6:121812425-121812447 TTTAAATACAAGTCCCTGCAGGG + Intergenic
1015624199 6:135163123-135163145 TTAAAATAGAATTTCAGGCTGGG + Intergenic
1015943485 6:138475653-138475675 TTAAAAAGCAAGGCCGGGCATGG + Intronic
1015981322 6:138842479-138842501 TAAAAATAAAAGTCCGGGTGCGG + Intronic
1016624184 6:146146375-146146397 ATACAATAGTAGGCCGGGCACGG - Intronic
1016808689 6:148238512-148238534 AGAAAATAAAAGTCCAGGCACGG - Intergenic
1017242476 6:152186264-152186286 TTAGAAGGGAAGACCGGGCACGG + Intronic
1018424442 6:163667676-163667698 TCATAATGGAAGTCCTGGCACGG + Intergenic
1018476313 6:164145698-164145720 TAAAAATTGAAGGCCGGGCGCGG + Intergenic
1018773288 6:166991256-166991278 TAAAAATTGAAGGCCAGGCATGG - Intergenic
1019076486 6:169392703-169392725 TTAAAATAGAGGTTGGGGGAAGG - Intergenic
1019557042 7:1637611-1637633 TGAAAATAGAAGGTCAGGCATGG + Intergenic
1020042808 7:5016938-5016960 CAAAAAAAGAAGTCCGGGCGCGG + Intronic
1020228536 7:6299091-6299113 AAAAAATAAAAGACCGGGCACGG + Intergenic
1020289543 7:6712185-6712207 CAAAAAAAGAAGTCCGGGCGCGG + Intergenic
1020703175 7:11509540-11509562 TTAAAAGATAAGGCCGGGCGCGG + Intronic
1020722414 7:11764289-11764311 TTAAAAGTAAAGACCGGGCATGG + Intronic
1020896125 7:13942311-13942333 TTAAAAAAAGAGGCCGGGCACGG - Intronic
1021387101 7:20044771-20044793 ATAAAATAGAAGTAAGGGTATGG + Intergenic
1021460008 7:20875654-20875676 TTAAAATTGAAATCTGGGCCGGG - Intergenic
1021530196 7:21635444-21635466 TTAAAAAAATAGGCCGGGCACGG - Intronic
1021881161 7:25096717-25096739 AAAAAAAAAAAGTCCGGGCACGG - Intergenic
1022057489 7:26754071-26754093 TTAAAAAAGTAAGCCGGGCACGG + Intronic
1022930507 7:35107612-35107634 TTAAAAGAGAAGTCAGGGGAAGG + Intergenic
1023649815 7:42357651-42357673 TTTAAAAAGGAGGCCGGGCACGG - Intergenic
1023846692 7:44124806-44124828 TTAAAATATAAGGCTGGGCGTGG - Intergenic
1023911037 7:44556690-44556712 TTAAAAAACAAGGCCAGGCATGG - Intergenic
1023975116 7:45023220-45023242 TAAAAAAAGAAGTCTGGGCCGGG - Intronic
1024709569 7:51999899-51999921 ATAAAAGAGTAGGCCGGGCACGG - Intergenic
1025095908 7:56095154-56095176 TAAAAATAAAAGGCCAGGCATGG - Intergenic
1025289300 7:57699678-57699700 TTAAAATAATAGGCCAGGCATGG - Intergenic
1026070531 7:67115257-67115279 TTTAAATAGAAGTCCAGTTAAGG + Intronic
1026096047 7:67347301-67347323 TTAAAAAATAAGGCTGGGCACGG + Intergenic
1026122552 7:67550416-67550438 TTCAAATAGAACTCCTGGCCAGG + Intergenic
1026122775 7:67552014-67552036 TTGAAATAGAAATCCTGGCCAGG - Intergenic
1026243171 7:68594882-68594904 TCAAAATAGATGGCTGGGCATGG + Intergenic
1026251233 7:68672669-68672691 TTAAAATATAGGTTCGGGCCAGG - Intergenic
1026569826 7:71519752-71519774 TTAAAATACTAGGCTGGGCACGG - Intronic
1026600887 7:71776397-71776419 TAAAAATAGTAGGCCGGGCGCGG - Intergenic
1026662540 7:72314703-72314725 TTAAAAAATATGGCCGGGCACGG - Intronic
1026737523 7:72958531-72958553 GAAAAAAAAAAGTCCGGGCATGG - Intergenic
1026926547 7:74198062-74198084 TAAAAATAGATGTCAGGGCCAGG - Intergenic
1027106210 7:75406537-75406559 GAAAAAAAAAAGTCCGGGCATGG + Intronic
1027180057 7:75932475-75932497 TTAAAATAGAAATTCTGGCCAGG - Intronic
1027218370 7:76198606-76198628 TTATAAGAGAGGGCCGGGCATGG + Intergenic
1027582741 7:80019536-80019558 TTAAAAGAGAAGTGTAGGCATGG + Intergenic
1027893259 7:84005650-84005672 TTAAAATAGTAGTGCAGGCCAGG + Intronic
1029157538 7:98527972-98527994 TTAAAAATGCAGTCCTGGCAGGG - Intergenic
1029244300 7:99187779-99187801 TTAAAAAAAAAGGCCGGGCACGG - Intronic
1029744426 7:102509095-102509117 TTTAAAAAAAAGGCCGGGCACGG - Intronic
1029762417 7:102608257-102608279 TTTAAAAAAAAGGCCGGGCACGG - Intronic
1029826400 7:103200126-103200148 TTAAAAGAGAAGTCAGGGGAAGG + Intergenic
1029916624 7:104216293-104216315 TTAAAATTTAAGGCCGGGCGCGG - Intergenic
1030388251 7:108892440-108892462 TTAAAATGGAAGTTTGGCCAAGG - Intergenic
1030774190 7:113513338-113513360 TTAAAACATCAGGCCGGGCATGG - Intergenic
1030857559 7:114580285-114580307 TTAAGAAAGAAGGACGGGCACGG + Intronic
1032379132 7:131457623-131457645 TAAAAATTTAAGCCCGGGCACGG + Intronic
1032827369 7:135584098-135584120 TTAAGAAACAAGGCCGGGCAGGG - Intronic
1033212598 7:139471136-139471158 CAAAAATGGAAGTCCGGGCCCGG - Intronic
1033342109 7:140500122-140500144 TTTAAATAGAAGGCCAGGCATGG - Intergenic
1033347378 7:140536060-140536082 TTCATAGAGAAGGCCGGGCATGG + Intronic
1033651555 7:143347328-143347350 CTAAAATGGGAGGCCGGGCATGG + Intronic
1033883961 7:145921445-145921467 TGAAAGTAGAAGTCAGGGCCGGG - Intergenic
1035416953 7:158697309-158697331 TAAAAATAGATGGCTGGGCATGG + Intronic
1036492329 8:9239204-9239226 TTAAAAAAGAAAGCCTGGCATGG - Intergenic
1036592436 8:10181205-10181227 TTAAAGCAGAAGGCCTGGCAGGG + Intronic
1037187265 8:16079124-16079146 TTAAATGAGCAGGCCGGGCACGG + Intergenic
1037512199 8:19594840-19594862 TTAAAATTAAAGTCCGGGTGTGG - Intronic
1038386497 8:27152777-27152799 TTAAAATTGAGGCCGGGGCATGG - Intergenic
1038501674 8:28050093-28050115 ATTAAATAAAAGGCCGGGCACGG + Intronic
1038590675 8:28834516-28834538 TGAGAAGAGAAGTCCAGGCATGG - Intronic
1038820332 8:30946150-30946172 AAAAAAAAAAAGTCCGGGCACGG + Intergenic
1039017462 8:33167684-33167706 AAAAAAAAAAAGTCCGGGCACGG - Intergenic
1039462359 8:37755661-37755683 TTAAACCAGAAGTCTGGGCATGG - Exonic
1039729530 8:40259045-40259067 AAAAAAAAAAAGTCCGGGCACGG + Intergenic
1039805870 8:40997534-40997556 ATTAAATAGAAGTCTGGGCATGG - Intergenic
1041049936 8:53924476-53924498 TTAAAAAACTAGTCCAGGCACGG - Intronic
1041065363 8:54077503-54077525 ATAAAAAAGTAGTCTGGGCACGG + Intronic
1041910141 8:63080429-63080451 CTAATAAAGAAGGCCGGGCATGG + Intronic
1041971582 8:63749183-63749205 TAAACTTAGAACTCCGGGCATGG - Intergenic
1042025211 8:64415646-64415668 TTAAAAGATAAGGCTGGGCATGG - Intergenic
1042311682 8:67385018-67385040 TTAAAAAAGGAGGCCGGGCGCGG - Intergenic
1042504799 8:69548749-69548771 TTAACATCCAAGTCTGGGCACGG - Intronic
1044666202 8:94636812-94636834 TAAAAATGTAAGGCCGGGCATGG - Intergenic
1045053275 8:98345990-98346012 TTAACAGAGCTGTCCGGGCATGG + Intergenic
1045183234 8:99809437-99809459 TTCTAATAAAAGTCCCGGCATGG - Exonic
1045566742 8:103324656-103324678 TTAAAATACATGTTGGGGCATGG - Exonic
1045735345 8:105289716-105289738 CTAAAATATAAGGCCGGGCGCGG + Intronic
1046973349 8:120247131-120247153 TTAATATTGAAGGCTGGGCATGG + Intronic
1047094500 8:121609415-121609437 GTAAATTTGAAGGCCGGGCATGG - Intergenic
1047259327 8:123241652-123241674 TTAAAATAAGAGGCCGGGCGCGG + Intronic
1047294183 8:123556626-123556648 TTAAAAAAAGAGGCCGGGCACGG - Intergenic
1047489863 8:125365563-125365585 ATAAAATCCAAGTCCAGGCACGG + Intronic
1047813500 8:128436211-128436233 TTAAAAAAGAAGCCCTAGCAAGG + Intergenic
1048392410 8:133980208-133980230 TTAAATTTGAAGTGGGGGCAGGG - Intergenic
1048507926 8:135037198-135037220 TTAAAATGCAAGGCTGGGCACGG - Intergenic
1048593869 8:135846030-135846052 TAAAAATACAATACCGGGCATGG + Intergenic
1050444604 9:5706166-5706188 ATGAATTAGAAGTCCGGGGATGG + Intronic
1050947248 9:11541302-11541324 TTAAAATAATAGGCCGCGCATGG + Intergenic
1053214598 9:36259955-36259977 TTAAAAAAGAAATCTGGGCCTGG - Intronic
1053580999 9:39403912-39403934 TTAATAAAGAAGTCCTGGCTGGG - Intergenic
1053845490 9:42231966-42231988 TTAATAAAGAAGTCCTGGCTGGG - Intergenic
1054102586 9:60962716-60962738 TTAATAAAGAAGTCCTGGCTGGG - Intergenic
1055863017 9:80776819-80776841 TTAAAATAGAAGTAAAGGCTGGG + Intergenic
1057775113 9:98001480-98001502 TTAAAAGAGAAGGCCAGGCATGG - Intronic
1057923269 9:99117386-99117408 AAAAAATTGAAGGCCGGGCACGG - Intronic
1058340588 9:103891321-103891343 TTAAAAAATTAGGCCGGGCATGG + Intergenic
1058668269 9:107339988-107340010 TAAAAACACTAGTCCGGGCACGG + Intergenic
1059241830 9:112812854-112812876 TTAAAACAACAGGCCGGGCATGG + Intronic
1060463129 9:123877531-123877553 TTAAAAAAACAGGCCGGGCATGG + Intronic
1060621438 9:125070738-125070760 TTAAATTACAAGGCCAGGCATGG + Intronic
1203472915 Un_GL000220v1:124535-124557 TTAAAAATGAAGGCCGGGCGCGG - Intergenic
1185552257 X:992568-992590 TAAAAATGTAAGGCCGGGCATGG + Intergenic
1185597917 X:1319284-1319306 TTTAAAAAGGAGGCCGGGCATGG - Intergenic
1185626731 X:1487813-1487835 GTAAAAAAGAAGGCCGGGCCAGG + Intronic
1185767783 X:2739742-2739764 TTAAAATGGAATGCCAGGCACGG - Intronic
1185850472 X:3481167-3481189 TTTAAAAATAAGGCCGGGCATGG - Intergenic
1186147314 X:6637902-6637924 TTAAACAAGAACTCCGGGCCTGG + Intergenic
1186473684 X:9840557-9840579 TGAAAATAGCAGGCCAGGCAAGG - Intronic
1186477430 X:9868532-9868554 TAAAAATAAAAGGCTGGGCACGG - Intronic
1187376521 X:18760275-18760297 TTAAAAAATAAGGCCAGGCACGG - Intronic
1187609082 X:20920821-20920843 TTATATTAGAATTCCGTGCATGG - Intergenic
1187700199 X:21957574-21957596 TTGAAAAAGAAGGCCGGGCACGG - Intronic
1187823618 X:23313587-23313609 TTAAAATTTAAGTCTGGGCTGGG + Intergenic
1189030035 X:37441058-37441080 TTAAAATAGATGGCCGGGCATGG - Intronic
1189441829 X:41043495-41043517 ATAAGCTAGAAGGCCGGGCAGGG + Intergenic
1189465134 X:41272731-41272753 ATAAAATTAAAGGCCGGGCACGG + Intergenic
1189704710 X:43748376-43748398 AAAAAATAAAAGGCCGGGCACGG + Intergenic
1190130288 X:47741853-47741875 GTAAAATAAAAGGCCAGGCATGG + Intergenic
1190192139 X:48286124-48286146 TAAAAATAAAAGGCCGGGCATGG + Intergenic
1190222775 X:48522961-48522983 CTAAAAAAGAAGGCCGGGCGCGG - Intronic
1190229482 X:48571122-48571144 TTAGAAGAGAAGGCCGGGCACGG + Intergenic
1190299113 X:49045891-49045913 TTAAAAAATTAGGCCGGGCATGG + Intergenic
1190865106 X:54377852-54377874 TGAAAAAAGTAGGCCGGGCACGG + Intergenic
1192279314 X:69667401-69667423 TTAAAAGAGACGGCCAGGCACGG - Intronic
1192626035 X:72729796-72729818 TTTAAAAATAAGGCCGGGCATGG - Intergenic
1193144877 X:78066350-78066372 TTAAAATAGAAATTCTGGGATGG + Intronic
1193156989 X:78184149-78184171 TTAAAGAAAAAGGCCGGGCATGG + Intergenic
1193426768 X:81349051-81349073 CTAAAAAAGAAGTCCTGGCCGGG - Intergenic
1193999757 X:88413155-88413177 TTAAAATAGGAGGCTGGGCACGG - Intergenic
1195312159 X:103642310-103642332 GTAAGTTAGAAGTCCAGGCATGG - Intergenic
1196314332 X:114204880-114204902 ATAAAATAGAATTCAAGGCAAGG + Intergenic
1196356882 X:114805423-114805445 TTAAAATTGAAGTCAGGAAATGG - Intronic
1196425853 X:115568741-115568763 TAAAAAAAGAAGGCTGGGCATGG + Intronic
1196643089 X:118086224-118086246 ATAAAAAAGACATCCGGGCATGG - Intronic
1197187780 X:123607592-123607614 TTAAGATACAAGGCCAGGCATGG - Intronic
1197283474 X:124565797-124565819 TTAAAATATAAGTATGGGCAGGG - Intronic
1197496332 X:127186232-127186254 TAAAGACAGAAGGCCGGGCACGG - Intergenic
1197738053 X:129867341-129867363 TAAAAATATTAGGCCGGGCATGG + Intergenic
1197784808 X:130188905-130188927 ATAAAATAGGAGGCTGGGCATGG - Intergenic
1198217028 X:134564970-134564992 AAAAAAAAAAAGTCCGGGCATGG - Intergenic
1198264064 X:134993137-134993159 TAAAAATTGAAGGCTGGGCACGG + Intergenic
1198397826 X:136239916-136239938 TGAAAATACAAGGCCAGGCATGG + Intronic
1198685747 X:139226466-139226488 TTAAAATAGAAGTCACGGTATGG + Intergenic
1198755229 X:139975393-139975415 TAAAAATAGAGGGCCGGCCACGG - Intergenic
1198863527 X:141096215-141096237 TGAAAATAGAAGGCTGGGCCTGG + Intergenic
1198899162 X:141491172-141491194 TGAAAATAGAAGGCTGGGCCTGG - Intergenic
1199106159 X:143871372-143871394 TAAGAATAGCAGGCCGGGCACGG + Intergenic
1199130522 X:144180832-144180854 TTAAAATAGTAGTCAAGGCTAGG - Intergenic
1199199629 X:145071733-145071755 TTAAAAAAGAAATCCTGGCCGGG - Intergenic
1199272067 X:145895826-145895848 TTAAAAAATCAGGCCGGGCAAGG - Intergenic
1201565344 Y:15359541-15359563 TTAAAATGGAAAGCCGGGGAGGG + Intergenic
1201779640 Y:17705371-17705393 TAAAAATAAAAGGCCTGGCATGG + Intergenic
1201780762 Y:17719911-17719933 TTAAAATTCATGGCCGGGCATGG + Intergenic
1201820791 Y:18186079-18186101 TTAAAATTCATGGCCGGGCATGG - Intergenic
1201821915 Y:18200621-18200643 TAAAAATAAAAGGCCTGGCATGG - Intergenic