ID: 1164706288

View in Genome Browser
Species Human (GRCh38)
Location 19:30322761-30322783
Sequence TAAGGGGCTCGGTGGGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164706288_1164706304 26 Left 1164706288 19:30322761-30322783 CCTCCTGCCCACCGAGCCCCTTA No data
Right 1164706304 19:30322810-30322832 TGGCCTGCGGTCCTGCCTCATGG 0: 1
1: 0
2: 4
3: 18
4: 162
1164706288_1164706298 -5 Left 1164706288 19:30322761-30322783 CCTCCTGCCCACCGAGCCCCTTA No data
Right 1164706298 19:30322779-30322801 CCTTACTCTCACTCCTAGTGGGG 0: 1
1: 0
2: 1
3: 6
4: 119
1164706288_1164706296 -6 Left 1164706288 19:30322761-30322783 CCTCCTGCCCACCGAGCCCCTTA No data
Right 1164706296 19:30322778-30322800 CCCTTACTCTCACTCCTAGTGGG 0: 1
1: 0
2: 0
3: 11
4: 227
1164706288_1164706299 -4 Left 1164706288 19:30322761-30322783 CCTCCTGCCCACCGAGCCCCTTA No data
Right 1164706299 19:30322780-30322802 CTTACTCTCACTCCTAGTGGGGG 0: 1
1: 0
2: 1
3: 8
4: 90
1164706288_1164706300 6 Left 1164706288 19:30322761-30322783 CCTCCTGCCCACCGAGCCCCTTA No data
Right 1164706300 19:30322790-30322812 CTCCTAGTGGGGGCCTCAGATGG 0: 1
1: 0
2: 2
3: 14
4: 163
1164706288_1164706294 -7 Left 1164706288 19:30322761-30322783 CCTCCTGCCCACCGAGCCCCTTA No data
Right 1164706294 19:30322777-30322799 CCCCTTACTCTCACTCCTAGTGG 0: 1
1: 0
2: 3
3: 9
4: 132
1164706288_1164706302 13 Left 1164706288 19:30322761-30322783 CCTCCTGCCCACCGAGCCCCTTA No data
Right 1164706302 19:30322797-30322819 TGGGGGCCTCAGATGGCCTGCGG 0: 1
1: 0
2: 4
3: 29
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164706288 Original CRISPR TAAGGGGCTCGGTGGGCAGG AGG (reversed) Intronic
No off target data available for this crispr