ID: 1164706294

View in Genome Browser
Species Human (GRCh38)
Location 19:30322777-30322799
Sequence CCCCTTACTCTCACTCCTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 132}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164706285_1164706294 7 Left 1164706285 19:30322747-30322769 CCTCCATTCACAGCCCTCCTGCC 0: 1
1: 0
2: 8
3: 44
4: 538
Right 1164706294 19:30322777-30322799 CCCCTTACTCTCACTCCTAGTGG 0: 1
1: 0
2: 3
3: 9
4: 132
1164706284_1164706294 8 Left 1164706284 19:30322746-30322768 CCCTCCATTCACAGCCCTCCTGC 0: 1
1: 0
2: 3
3: 30
4: 428
Right 1164706294 19:30322777-30322799 CCCCTTACTCTCACTCCTAGTGG 0: 1
1: 0
2: 3
3: 9
4: 132
1164706286_1164706294 4 Left 1164706286 19:30322750-30322772 CCATTCACAGCCCTCCTGCCCAC 0: 1
1: 0
2: 5
3: 56
4: 536
Right 1164706294 19:30322777-30322799 CCCCTTACTCTCACTCCTAGTGG 0: 1
1: 0
2: 3
3: 9
4: 132
1164706288_1164706294 -7 Left 1164706288 19:30322761-30322783 CCTCCTGCCCACCGAGCCCCTTA No data
Right 1164706294 19:30322777-30322799 CCCCTTACTCTCACTCCTAGTGG 0: 1
1: 0
2: 3
3: 9
4: 132
1164706283_1164706294 26 Left 1164706283 19:30322728-30322750 CCATGAACTCTTCATGAGCCCTC 0: 1
1: 0
2: 0
3: 9
4: 157
Right 1164706294 19:30322777-30322799 CCCCTTACTCTCACTCCTAGTGG 0: 1
1: 0
2: 3
3: 9
4: 132
1164706289_1164706294 -10 Left 1164706289 19:30322764-30322786 CCTGCCCACCGAGCCCCTTACTC 0: 1
1: 0
2: 1
3: 11
4: 213
Right 1164706294 19:30322777-30322799 CCCCTTACTCTCACTCCTAGTGG 0: 1
1: 0
2: 3
3: 9
4: 132
1164706287_1164706294 -6 Left 1164706287 19:30322760-30322782 CCCTCCTGCCCACCGAGCCCCTT 0: 1
1: 0
2: 3
3: 37
4: 362
Right 1164706294 19:30322777-30322799 CCCCTTACTCTCACTCCTAGTGG 0: 1
1: 0
2: 3
3: 9
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164706294 Original CRISPR CCCCTTACTCTCACTCCTAG TGG Intronic
902850392 1:19151070-19151092 CCCCTACCCCTCACTCCCAGGGG + Intronic
905359036 1:37405753-37405775 CCGCATATTCTCACTCATAGTGG + Intergenic
907488723 1:54795151-54795173 CCCCTGCCTCTCACTCCTCTAGG + Intronic
908411551 1:63870848-63870870 CCCCAGCCTCTCACTCCCAGTGG - Intronic
914951992 1:152124428-152124450 GCCCTCCCTCTCACTCATAGGGG + Intergenic
917539232 1:175897494-175897516 GCCCTTACCCTCACCCCCAGTGG + Intergenic
918243641 1:182640964-182640986 CCCCTTCCACTCTCTCCTGGAGG + Intergenic
919956509 1:202422356-202422378 TCCCATCCTCTCACTCCCAGTGG - Intronic
923229016 1:231966285-231966307 CCACTTACTCTCACTCCTTCAGG + Intronic
923312251 1:232746462-232746484 ACCCTTACTGTTTCTCCTAGTGG - Intergenic
924130481 1:240901777-240901799 CTCCTCATTCCCACTCCTAGTGG + Intronic
924280316 1:242430589-242430611 CCCCTTACTCCTACTCCTAGTGG + Intronic
1064026505 10:11853029-11853051 ACCATGACACTCACTCCTAGAGG + Intronic
1068530556 10:58181097-58181119 ACCCTCATTCTCACTGCTAGTGG + Intergenic
1070519452 10:77239211-77239233 CCACTTCCTCCCACTGCTAGAGG + Intronic
1070742306 10:78911138-78911160 ACCTGTCCTCTCACTCCTAGTGG + Intergenic
1071178438 10:82954895-82954917 TCCCTTACTTTCACTCATAAAGG + Intronic
1076597157 10:131630944-131630966 CCACTCACTCACACTCCTATGGG + Intergenic
1076994838 11:292829-292851 CCAGTCACTCTCATTCCTAGTGG - Intronic
1077985576 11:7347991-7348013 CCCCTTCCCCTCACTCCTCCAGG - Intronic
1079011964 11:16835945-16835967 CACCTCACTCTCAGTCCTCGCGG + Intronic
1079137075 11:17781476-17781498 CCTCTTTCTCTCCCTCCTGGGGG - Intronic
1080783668 11:35454655-35454677 TCCCTCAGTCTCACTCCTGGAGG + Intronic
1083969878 11:66068407-66068429 ACCCTCACTCTCACCACTAGAGG - Intronic
1084939883 11:72606859-72606881 CCCCTTACTCTCAGCCCTCTGGG + Intronic
1088192331 11:107239832-107239854 TCCCTTCCTCTCACTCCTTCTGG - Intergenic
1089632081 11:119790116-119790138 CCCCTCACACTCATTCCTGGTGG + Intergenic
1092560242 12:9605063-9605085 CCGCATATTCTCACTCATAGTGG - Intronic
1093712942 12:22348360-22348382 CCCGCTACTCAGACTCCTAGGGG - Intronic
1093787662 12:23211470-23211492 TCTCTTACTCACAGTCCTAGAGG - Intergenic
1096654382 12:53079398-53079420 CGCCTTTCCTTCACTCCTAGAGG + Exonic
1099408973 12:82300869-82300891 TGCCTTACTCTCACTTCTTGGGG - Intronic
1099940671 12:89184289-89184311 TCCCTTTCTCCCACTCCAAGTGG - Intergenic
1102422445 12:112814702-112814724 CCCCTTTCTCACACTCAGAGGGG - Intronic
1105981303 13:25519077-25519099 CTCTTTACTCTCCCTCCTACAGG + Intronic
1106457945 13:29943976-29943998 CCCTTTCCTCTCAGTCCCAGTGG - Intergenic
1111449071 13:88390687-88390709 CCCTTTACTCTCTCCTCTAGAGG - Intergenic
1117442061 14:55769342-55769364 CCCATTATTCTTACTTCTAGCGG - Intergenic
1118475152 14:66109620-66109642 TCCCTCACCATCACTCCTAGTGG + Intergenic
1120567172 14:86074716-86074738 CCGCATATTCTCACTCATAGGGG - Intergenic
1122314635 14:100818460-100818482 CCCCTTGCCCTCCCTCCTTGTGG - Intergenic
1124343410 15:28904553-28904575 CCCCTCACTCTCACTGTCAGTGG - Intronic
1126879330 15:53077823-53077845 CTCCTTTCTCTCACCCCAAGTGG + Intergenic
1127044201 15:55008912-55008934 CCCCTGACTTTCACTCTTACAGG + Intergenic
1127986678 15:64077934-64077956 CCCCTTACTCTAAATACTATAGG - Intronic
1131456192 15:92584485-92584507 CCACTTACTCTCTCTCCTTGCGG + Intergenic
1133778768 16:8919985-8920007 CCCCTTCCTCACACTCGGAGAGG + Intronic
1133981158 16:10634214-10634236 CCCTTTAGTCTCACTCCTAGGGG - Intronic
1139530941 16:67542479-67542501 CCCCTCACTCACACTACTACAGG + Exonic
1143018648 17:3904927-3904949 CCCCTGCCCCTCACTTCTAGGGG - Exonic
1149867021 17:60156759-60156781 CCCCATCCTCTCAGTCCTTGGGG - Intronic
1151971009 17:77457402-77457424 CCCATCACTCTCACTGCTTGAGG + Intronic
1155249141 18:23938816-23938838 CCCCTTTCTCTCCCTCCTTTGGG - Intronic
1156363279 18:36403183-36403205 CTCCTTCCTCTCTCCCCTAGGGG + Intronic
1160050809 18:75431535-75431557 CCCCTTCCTCCCACCCCTGGTGG + Intergenic
1163807713 19:19410005-19410027 CCCCTCTCTCCCACACCTAGAGG - Intronic
1164393551 19:27845468-27845490 CCCCTTACTTCCCCTCCGAGAGG - Intergenic
1164706294 19:30322777-30322799 CCCCTTACTCTCACTCCTAGTGG + Intronic
1166291246 19:41864963-41864985 ACCCTTCCTCTCCCTTCTAGTGG + Intronic
1168124543 19:54276246-54276268 CCTCTTCCTCTCACTCACAGAGG + Exonic
1168177443 19:54635292-54635314 CCTCTTCCTCTCACTCACAGAGG - Exonic
1168654528 19:58117845-58117867 CCTCTAACTCTCTCTCCTAGTGG - Intronic
926122673 2:10253446-10253468 CTCCTTGCTCTGACTCCGAGGGG + Intergenic
928049395 2:27973628-27973650 CCCCGTACTCTGCCTCCCAGTGG - Intronic
929316157 2:40481629-40481651 CCCCCTACTCACAAGCCTAGTGG - Intronic
929911144 2:46090332-46090354 CCCCTGACTCCCTCCCCTAGTGG + Intronic
931021259 2:58047055-58047077 CGCCTTGTTCTCACTCCCAGCGG - Intronic
934236593 2:90238230-90238252 CTCCTTCCTCTCACTCCTGAGGG - Intergenic
935093623 2:99922202-99922224 CCCAGCACTTTCACTCCTAGGGG + Intronic
937516079 2:122656784-122656806 CACCTTACTCTCTGACCTAGTGG - Intergenic
938574718 2:132593281-132593303 TCCCCTCCTCTCCCTCCTAGAGG + Intronic
939653412 2:144791996-144792018 CCCTTTATTCTCACTTCTAATGG + Intergenic
940830954 2:158464827-158464849 CCCCTCACTTGCACCCCTAGTGG - Intronic
943819321 2:192299960-192299982 CCCAATACTCTCACTCCAACTGG + Intergenic
944026534 2:195176430-195176452 CCGCATATTCTCACTCATAGTGG - Intergenic
944527154 2:200630839-200630861 CCCCTTACCCCCACTCCTACAGG - Intronic
945813661 2:214577461-214577483 CCCCTCACTCCCACTCCTTAGGG - Exonic
946128695 2:217587331-217587353 CCCCTTACTCCCAATTCTGGAGG - Intronic
947819364 2:233059700-233059722 CCCATTACCCTCATTCCCAGGGG - Intergenic
1168964580 20:1891637-1891659 ACTCTTCCTCTTACTCCTAGAGG - Intergenic
1169207711 20:3749486-3749508 CCCCTAACTCCCACTCCTCCAGG + Intronic
1170827339 20:19808324-19808346 CCCCTTCCCCTGACTCCTACTGG - Intergenic
1172843606 20:37916363-37916385 CCACCTGCTCTCACTCCTTGTGG + Intronic
1173155980 20:40609491-40609513 CCACATATTCTCACTCATAGTGG + Intergenic
1179180875 21:39043887-39043909 CCCCTTCCCCTCAGGCCTAGAGG + Intergenic
1184763754 22:46561054-46561076 CCCCTTCCTCACCCTCCTGGGGG - Intergenic
949840498 3:8314800-8314822 CCACTTTCTCTCAGTCCTGGAGG - Intergenic
950134210 3:10569297-10569319 CCCCTCACTCACATCCCTAGTGG + Intronic
953926388 3:46984796-46984818 CCTCTTACTGTCACTCACAGAGG + Intronic
959959016 3:112274541-112274563 CCGCCTCCTCTCACTACTAGTGG + Intronic
961819281 3:129567023-129567045 ACCCTCACTCTACCTCCTAGTGG - Intronic
965065119 3:163838903-163838925 CCCCGTGCTCAAACTCCTAGGGG + Intergenic
965259871 3:166468236-166468258 CCCCTTGCTATTACCCCTAGTGG + Intergenic
966636704 3:182142674-182142696 CACTTTACTCTCATTCCTATGGG - Intergenic
966641077 3:182191363-182191385 CTCCTTTCTCTCACTCTTACTGG - Intergenic
966760303 3:183412219-183412241 CCCTTTGCACTGACTCCTAGGGG - Intronic
967471605 3:189868560-189868582 CCCTTTATTCTAATTCCTAGTGG + Exonic
970823054 4:20241935-20241957 TCCCATACTCTCACTCATAATGG + Intergenic
975252213 4:72193531-72193553 CCCCTCACTCTCGCTCCTGCTGG - Intergenic
979195506 4:117916143-117916165 CCACGGACTCCCACTCCTAGGGG - Intergenic
980353453 4:131713151-131713173 TCTCTTACTTTCATTCCTAGAGG - Intergenic
983497624 4:168461098-168461120 CCTCTTACTCTCCTTCCCAGAGG + Intronic
984286984 4:177742918-177742940 CTACTTACTCTCTCTCCCAGTGG - Intronic
985867508 5:2525349-2525371 ACCCTTAGTCTCTCTGCTAGGGG - Intergenic
986401388 5:7384869-7384891 CCCCTTCCCCTCACTCCTAGGGG + Intergenic
994968415 5:106703729-106703751 TACCTTTTTCTCACTCCTAGAGG + Intergenic
995451449 5:112305893-112305915 CCTCTTACTTTTACTCCTAAAGG - Intronic
997213126 5:132089328-132089350 CCCTTTACTATCATTCCCAGTGG - Intergenic
997419175 5:133752304-133752326 GCCCTCTCTCTCACTCCCAGGGG - Intergenic
998152282 5:139764401-139764423 CCCCTCACTCACACTCCCAGGGG - Intergenic
1000957441 5:167559675-167559697 CCCCTTACTCCCACCCCTACAGG - Intronic
1003860381 6:10317334-10317356 CCCCTTCCTAGCAATCCTAGAGG - Intergenic
1007178124 6:39910085-39910107 CCTCTGTCTCTCACTGCTAGGGG - Intronic
1012701400 6:102461393-102461415 CCGCATATTCTCACTCATAGTGG + Intergenic
1013337732 6:109181776-109181798 CCCCTTACTCCCACTTCTTTGGG + Intergenic
1017068158 6:150549172-150549194 TGCCTCACTCTCAGTCCTAGGGG + Intergenic
1020361117 7:7327938-7327960 CCCCTTTCTCTCCATCCTACTGG - Intergenic
1021858363 7:24880417-24880439 CCCCCTACTCTCTCCCCCAGCGG + Intronic
1022015924 7:26348178-26348200 CCCCTCACTTCCACCCCTAGAGG + Intronic
1024098991 7:46009925-46009947 CCCCTTACCTTCACTCACAGTGG + Intergenic
1028622562 7:92841170-92841192 CCCTTTGCTCTAACTCCTTGAGG + Intergenic
1029027077 7:97428194-97428216 CCCCTTAGATTCAGTCCTAGAGG + Intergenic
1030394293 7:108966219-108966241 CCCCTTGCTCTCAGCCCTAAAGG - Intergenic
1030454854 7:109760544-109760566 CCACTGACTCTCACCCCTCGTGG - Intergenic
1034474416 7:151274413-151274435 CATCTTCCTCTCACTCCTTGAGG + Intronic
1037548221 8:19944428-19944450 CCCTTTTCTCTCACTCCTACAGG - Intronic
1038110473 8:24491461-24491483 ACCCTTGCTTTCACTGCTAGAGG - Intronic
1038808582 8:30817136-30817158 CCACTGACTCTTACTCATAGTGG + Intergenic
1044163781 8:88954574-88954596 CCCGTTACTCTCTCCCCTACTGG - Intergenic
1046720575 8:117614159-117614181 GCCTTTACTCACACTCCTTGAGG - Intergenic
1049377002 8:142294049-142294071 TCCCTTACTCCCTCTCCTCGTGG - Intronic
1050605133 9:7293124-7293146 CCCCTTCCTCTCACTCCTGCTGG + Intergenic
1051099818 9:13507918-13507940 CCACTTTCTCCCCCTCCTAGAGG + Intergenic
1057462006 9:95271504-95271526 CACCTTCCTCTCACTTCTGGCGG - Intronic
1057907647 9:98994850-98994872 CCCCTTACCCTCACTCCTGAGGG + Intronic
1060175668 9:121495772-121495794 TCCCTTACTCTCTCAGCTAGTGG + Intergenic
1187779457 X:22802333-22802355 TACCTTACTCTCTATCCTAGGGG + Intergenic
1189048528 X:37618967-37618989 CCTCTCACTCTTAATCCTAGTGG + Intronic
1191008060 X:55731912-55731934 TCTCTTCATCTCACTCCTAGTGG - Intronic
1192043249 X:67645024-67645046 CCCCATACCCTCTCACCTAGCGG + Intronic
1193307618 X:79968097-79968119 CCCTTTGCTGTCTCTCCTAGTGG - Intergenic
1199012981 X:142778813-142778835 CCAGTTGCTCTCACTCCTAATGG + Intergenic
1200420663 Y:2963000-2963022 CCCCTTACCCTCAGCCCTACAGG - Intronic
1201274714 Y:12286678-12286700 CCCCTTACTTCCCCTCCAAGAGG - Intergenic
1201970820 Y:19792622-19792644 CCACATGCTCTCACTCATAGTGG - Intergenic