ID: 1164706296

View in Genome Browser
Species Human (GRCh38)
Location 19:30322778-30322800
Sequence CCCTTACTCTCACTCCTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 227}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164706286_1164706296 5 Left 1164706286 19:30322750-30322772 CCATTCACAGCCCTCCTGCCCAC 0: 1
1: 0
2: 5
3: 56
4: 536
Right 1164706296 19:30322778-30322800 CCCTTACTCTCACTCCTAGTGGG 0: 1
1: 0
2: 0
3: 11
4: 227
1164706287_1164706296 -5 Left 1164706287 19:30322760-30322782 CCCTCCTGCCCACCGAGCCCCTT 0: 1
1: 0
2: 3
3: 37
4: 362
Right 1164706296 19:30322778-30322800 CCCTTACTCTCACTCCTAGTGGG 0: 1
1: 0
2: 0
3: 11
4: 227
1164706284_1164706296 9 Left 1164706284 19:30322746-30322768 CCCTCCATTCACAGCCCTCCTGC 0: 1
1: 0
2: 3
3: 30
4: 428
Right 1164706296 19:30322778-30322800 CCCTTACTCTCACTCCTAGTGGG 0: 1
1: 0
2: 0
3: 11
4: 227
1164706289_1164706296 -9 Left 1164706289 19:30322764-30322786 CCTGCCCACCGAGCCCCTTACTC 0: 1
1: 0
2: 1
3: 11
4: 213
Right 1164706296 19:30322778-30322800 CCCTTACTCTCACTCCTAGTGGG 0: 1
1: 0
2: 0
3: 11
4: 227
1164706288_1164706296 -6 Left 1164706288 19:30322761-30322783 CCTCCTGCCCACCGAGCCCCTTA No data
Right 1164706296 19:30322778-30322800 CCCTTACTCTCACTCCTAGTGGG 0: 1
1: 0
2: 0
3: 11
4: 227
1164706283_1164706296 27 Left 1164706283 19:30322728-30322750 CCATGAACTCTTCATGAGCCCTC 0: 1
1: 0
2: 0
3: 9
4: 157
Right 1164706296 19:30322778-30322800 CCCTTACTCTCACTCCTAGTGGG 0: 1
1: 0
2: 0
3: 11
4: 227
1164706285_1164706296 8 Left 1164706285 19:30322747-30322769 CCTCCATTCACAGCCCTCCTGCC 0: 1
1: 0
2: 8
3: 44
4: 538
Right 1164706296 19:30322778-30322800 CCCTTACTCTCACTCCTAGTGGG 0: 1
1: 0
2: 0
3: 11
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164706296 Original CRISPR CCCTTACTCTCACTCCTAGT GGG Intronic
902330289 1:15727962-15727984 CCCTAACTTTGGCTCCTAGTGGG + Intronic
905359037 1:37405754-37405776 CGCATATTCTCACTCATAGTGGG + Intergenic
906376302 1:45299496-45299518 CCCTTATTCTGACACCAAGTTGG - Intronic
907837719 1:58126683-58126705 CGCATATTCTCACTCCTAGGTGG - Intronic
910296181 1:85647777-85647799 CCCATATTCTCACTCATAGGTGG + Intergenic
915109988 1:153557708-153557730 CCCTGACTCTCAGTCCAAGCTGG + Intergenic
917187226 1:172372140-172372162 CGCATATTCTCACTCCTAGGTGG - Intronic
920064574 1:203258125-203258147 CACATATTCTCACTCATAGTTGG - Intronic
923229017 1:231966286-231966308 CACTTACTCTCACTCCTTCAGGG + Intronic
1064026507 10:11853030-11853052 CCATGACACTCACTCCTAGAGGG + Intronic
1065449300 10:25839530-25839552 CCCACTCTCTCACTCCAAGTGGG + Intergenic
1066017082 10:31258469-31258491 CCTTTGCTGTCACTCCTATTAGG + Intergenic
1066578785 10:36857099-36857121 CCCATATTCTCACTCTTAGATGG + Intergenic
1066788153 10:39028872-39028894 CCCATATTCTCACTCATAGGTGG + Intergenic
1068073266 10:52222492-52222514 CCCATATTCTCACTCCTGGTTGG - Intronic
1070742308 10:78911139-78911161 CCTGTCCTCTCACTCCTAGTGGG + Intergenic
1073660887 10:105475041-105475063 CGCTTGTTCTCACTCATAGTTGG - Intergenic
1074288415 10:112120064-112120086 CCCTTACTCTCAGGCCATGTTGG + Intergenic
1080783670 11:35454656-35454678 CCCTCAGTCTCACTCCTGGAGGG + Intronic
1081368119 11:42261563-42261585 CCATTCCTTTCACTTCTAGTAGG - Intergenic
1082133044 11:48514398-48514420 CGCATATTCTCACTCATAGTTGG - Intergenic
1082211676 11:49510687-49510709 CCCTGACTCTCCCTCCTCTTTGG - Intergenic
1083969876 11:66068406-66068428 CCCTCACTCTCACCACTAGAGGG - Intronic
1084668660 11:70592360-70592382 TCCTGCCTCTCACTCCGAGTGGG - Intronic
1086343948 11:85876205-85876227 CCTTTTCTCTCACTCCTTTTTGG + Intronic
1086515014 11:87601764-87601786 CTGTTACTTTCACTCCTATTTGG - Intergenic
1088192329 11:107239831-107239853 CCCTTCCTCTCACTCCTTCTGGG - Intergenic
1088764303 11:112961710-112961732 CCCTTCCTCCTACTCCTAGGAGG + Intronic
1089560056 11:119339290-119339312 CTCATGCTCTCACTCCTAGAAGG - Exonic
1090222964 11:125046612-125046634 TCCTTACTTTCACTACCAGTTGG + Intergenic
1092126889 12:6080854-6080876 CCCTTTCTCTCACTCCCCCTAGG + Intronic
1092560241 12:9605062-9605084 CGCATATTCTCACTCATAGTGGG - Intronic
1095152201 12:38808519-38808541 CGCATATTCTCACTCATAGTTGG + Intronic
1096312773 12:50535923-50535945 CCCATATTCTCACTCATAGGTGG - Intronic
1096840712 12:54378093-54378115 TCCCCACTCCCACTCCTAGTTGG - Intronic
1097814266 12:64054962-64054984 CGCATATTCTCACTCATAGTTGG - Intronic
1098036401 12:66307588-66307610 CCCTTACTCTCACTCTTGCTAGG + Intronic
1098582103 12:72112730-72112752 CCATTAATCACACTCCTAGATGG + Intronic
1099000536 12:77173611-77173633 CCCATATTCTCACTCATAGGTGG - Intergenic
1099158651 12:79211665-79211687 CGCATATTCTCACTCCTAGGTGG - Intronic
1099998569 12:89806805-89806827 CGCATATTCTCACTCATAGTTGG - Intergenic
1100639219 12:96465221-96465243 CCATAACTCCCACTCCTAGATGG - Intergenic
1103623360 12:122201738-122201760 TCCTTTCTCTCCCTCCCAGTTGG - Intronic
1104374242 12:128250003-128250025 CCCTTCCTCTCTCTTCTTGTTGG + Intergenic
1106059807 13:26278446-26278468 CCCTTTCCCTCACTACTAGATGG - Intronic
1107635193 13:42385161-42385183 CGCATATTCTCACTCATAGTTGG - Intergenic
1107639846 13:42430665-42430687 CCCATATTCTCACTCATAGGTGG + Intergenic
1107765697 13:43732122-43732144 CCCTTACTCCTCCTCCTACTTGG + Intronic
1111647590 13:91049965-91049987 CGCTTGCTCTCACTCATAGGTGG - Intergenic
1113151690 13:107270889-107270911 CGCATATTCTCACTCATAGTTGG - Intronic
1114838068 14:26227701-26227723 CCCTGACCCTCTCTCCTAATAGG - Intergenic
1114983476 14:28194224-28194246 CGCATATTCTCACTCATAGTTGG + Intergenic
1115261814 14:31462071-31462093 CCCTTACTCTAACTTCCAGCTGG - Intergenic
1116088048 14:40266702-40266724 CCCATATTCTCACTCATAGGTGG + Intergenic
1117536741 14:56709781-56709803 CCTTTATTCTCACTCCCAGGAGG - Intronic
1119139945 14:72257723-72257745 CCCTTCCTCTCTCTGCTAGAAGG - Intronic
1120372891 14:83660749-83660771 ACCTTAGATTCACTCCTAGTCGG + Intergenic
1120376256 14:83711294-83711316 CCCACATTCTCACTCTTAGTTGG - Intergenic
1120451046 14:84667264-84667286 CCCTTATTCTCACTCATATGTGG - Intergenic
1124343408 15:28904552-28904574 CCCTCACTCTCACTGTCAGTGGG - Intronic
1125218199 15:37303504-37303526 CCCATATTCTCACTCATAGGTGG - Intergenic
1125397862 15:39269782-39269804 CCCTTTCCTTCAATCCTAGTTGG + Intergenic
1126879331 15:53077824-53077846 TCCTTTCTCTCACCCCAAGTGGG + Intergenic
1126907216 15:53380801-53380823 CCCATATTCTCACTCATAGGTGG - Intergenic
1128604651 15:69027807-69027829 CCCTTGCGCTCACCCCAAGTGGG + Intronic
1129768807 15:78189588-78189610 CACATACTCTCACTCATAGGTGG + Intronic
1130458808 15:84142483-84142505 GCCTTCCTTTCTCTCCTAGTTGG + Intergenic
1133827594 16:9292111-9292133 CGCATATTCTCACTCATAGTTGG - Intergenic
1135786144 16:25350989-25351011 CCCTTTCTCTCACCCCCAGTTGG + Intergenic
1139117975 16:63979850-63979872 CCCTGACTCTGACCCATAGTAGG + Intergenic
1139798226 16:69499998-69500020 CACTTCCTCTCACTGCTAATTGG + Intergenic
1145687868 17:26693997-26694019 CACTTATTCTCACTCGTAGGTGG + Intergenic
1146156621 17:30529831-30529853 CCTTTCCTCTGACTCCTATTTGG - Intergenic
1153286281 18:3457673-3457695 CCCTTTCTCTCTCTGCCAGTCGG + Exonic
1153401278 18:4686424-4686446 CACATATTCTCACTCATAGTTGG + Intergenic
1153540210 18:6146031-6146053 CCCGTGCTCTCACTTCAAGTAGG - Intronic
1156308662 18:35903392-35903414 CGCATGCTCTCACTCATAGTTGG + Intergenic
1159184052 18:64947205-64947227 CCCTGTCTCTCACACCTATTGGG - Intergenic
1160710469 19:548903-548925 CCCTTCCTGTCACTCGTAGCTGG + Exonic
1164706296 19:30322778-30322800 CCCTTACTCTCACTCCTAGTGGG + Intronic
1166291248 19:41864964-41864986 CCCTTCCTCTCCCTTCTAGTGGG + Intronic
1166440060 19:42805675-42805697 CACATACTCTCACTCATAGGTGG - Intronic
1167379363 19:49129657-49129679 CCCTTAATCTCACTCTCACTGGG - Intronic
1168298476 19:55389530-55389552 CCCTTACTCTCAGTCAGAGCCGG - Intronic
1168654527 19:58117844-58117866 CTCTAACTCTCTCTCCTAGTGGG - Intronic
928106623 2:28474594-28474616 CCCTTGTTCTCTCTCCTAGCAGG + Intronic
929911146 2:46090333-46090355 CCCTGACTCCCTCCCCTAGTGGG + Intronic
930389746 2:50745962-50745984 CCCTTCCTCTCACTGCCAATGGG + Intronic
930626644 2:53706327-53706349 CCCTTGATCTAACTCCTATTAGG - Intronic
930636254 2:53808961-53808983 CCCTGACTCTTAGTACTAGTGGG + Intronic
930911137 2:56631461-56631483 CACTTATTCTCACTCATAGGTGG - Intergenic
932667828 2:73711168-73711190 CTCTGACCCTCACTCTTAGTTGG - Intergenic
933556738 2:83839410-83839432 CCCATATTCTCACTCATAGGTGG - Intergenic
933644678 2:84801012-84801034 CCCATATTCTCACTCATAGGTGG + Intronic
935638001 2:105264984-105265006 ACCTTTCTCTCACTCCTACAAGG - Exonic
937481523 2:122265328-122265350 CGCATATTCTCACTCCTAGGTGG - Intergenic
939066031 2:137484245-137484267 CGCATATTCTCACTCATAGTTGG - Intronic
939653414 2:144791997-144792019 CCTTTATTCTCACTTCTAATGGG + Intergenic
940081077 2:149801993-149802015 CACATACTCTCACTACTAATAGG - Intergenic
940346678 2:152636141-152636163 CCCTTGGTCACACTGCTAGTAGG - Intronic
941726957 2:168871123-168871145 CACATATTCTCACTCCTAGGTGG + Exonic
942716895 2:178903522-178903544 CGCATATTCTCACTCATAGTTGG + Intronic
943542856 2:189239535-189239557 CGCATATTCTCACTCATAGTTGG + Intergenic
943819323 2:192299961-192299983 CCAATACTCTCACTCCAACTGGG + Intergenic
943823881 2:192362960-192362982 CACATACTCTCACTCATAGGTGG + Intergenic
944026533 2:195176429-195176451 CGCATATTCTCACTCATAGTGGG - Intergenic
947098657 2:226594764-226594786 CGCTTGTTCTCACTCATAGTTGG - Intergenic
1168964579 20:1891636-1891658 CTCTTCCTCTTACTCCTAGAGGG - Intergenic
1169420760 20:5457331-5457353 CACATACTCTCACTCATAGGTGG - Intergenic
1169955456 20:11097808-11097830 CCTTCCCTCTGACTCCTAGTTGG - Intergenic
1170827337 20:19808323-19808345 CCCTTCCCCTGACTCCTACTGGG - Intergenic
1173155981 20:40609492-40609514 CACATATTCTCACTCATAGTGGG + Intergenic
1173421551 20:42905833-42905855 CGCATACTCTCACTCATAGGTGG + Intronic
1178016598 21:28353665-28353687 CGCATACTCTCACTCATAGGTGG + Intergenic
1179929636 21:44558661-44558683 CGCTTACTCTGACTCCTGGCAGG - Exonic
1180897925 22:19350816-19350838 CTTTTACTCTCACTTCTACTAGG + Intronic
1182149328 22:28017415-28017437 CCCTGACTCCCACTGCTGGTCGG + Intronic
1182992271 22:34779313-34779335 CCCATATTCTCACTCATAGGTGG - Intergenic
1183074896 22:35420616-35420638 CCCTTACTCTTAGTCCGAGATGG + Intronic
1185167281 22:49269466-49269488 GCCTTATTCTCACTCATAGGTGG - Intergenic
950134212 3:10569298-10569320 CCCTCACTCACATCCCTAGTGGG + Intronic
950588724 3:13918766-13918788 CGCATACTCTCACTCATAGGTGG + Intergenic
950982118 3:17318143-17318165 CCCATATTCTCACTCATAGATGG + Intronic
950984437 3:17345836-17345858 CCCATATTCTCACTCATAGATGG + Intronic
954088964 3:48269852-48269874 ACCTTACTCTCACTCCATGAAGG - Exonic
955305273 3:57824318-57824340 CCCTTTCTCTCTCTCCTTCTAGG - Intronic
956544132 3:70380768-70380790 CGCATACTCTCACTCATAGGTGG - Intergenic
957036492 3:75298182-75298204 CCCTTACTCTCCCTTCTACCTGG - Intergenic
957250287 3:77763903-77763925 CGCATATTCTCACTCATAGTTGG - Intergenic
959111595 3:102129344-102129366 CGCATACTCTCACTCATAGATGG + Intronic
959757255 3:109913481-109913503 CACATATTCTCACTCATAGTTGG - Intergenic
960398106 3:117161892-117161914 CCCTTACTCTCTCTCCATGAAGG - Intergenic
960989049 3:123298767-123298789 CCCTTCCTCTCACTCAAAGAAGG + Intronic
961398342 3:126614818-126614840 TCCTCCCTCTCCCTCCTAGTTGG + Intronic
961599979 3:128052735-128052757 CCCCTGCTCTCACTCGTCGTGGG + Intronic
963573274 3:147024983-147025005 CGCATATTCTCACTCCTAGGTGG + Intergenic
963655614 3:148045916-148045938 CCCTTGTTCTCACTCATAGGTGG - Intergenic
964957471 3:162379278-162379300 CGCATATTCTCACTCATAGTTGG - Intergenic
966641076 3:182191362-182191384 TCCTTTCTCTCACTCTTACTGGG - Intergenic
967116254 3:186341932-186341954 CCCATATTCTCACTCATAGGTGG + Intronic
967471607 3:189868561-189868583 CCTTTATTCTAATTCCTAGTGGG + Exonic
968692781 4:2003725-2003747 CCCTCACTCCCACCCCTATTAGG - Intronic
969187743 4:5490798-5490820 CGCATATTCTCACTCGTAGTTGG - Intronic
970985524 4:22152210-22152232 CGCATAGTCTCACTCCTAGGTGG + Intergenic
972639508 4:40912773-40912795 CCCTTACTCAGACTCCGAGAAGG - Intronic
974578167 4:63756511-63756533 CGCATATTCTCACTCATAGTTGG + Intergenic
974672637 4:65052386-65052408 CGCATATTCTCACTCATAGTTGG - Intergenic
976909793 4:90288259-90288281 CCTTTACTCACACTGCTACTTGG + Intronic
977882090 4:102216762-102216784 CTCTTACTCTCACTTTTATTTGG + Intergenic
977951668 4:102978033-102978055 CTCTTATTCTCACTCTTAGATGG - Intronic
980420276 4:132549648-132549670 GCCTTATTCTAAATCCTAGTAGG - Intergenic
980617583 4:135251334-135251356 CCCATATTCTCACTCATAGGTGG + Intergenic
981544947 4:145884136-145884158 CCCTCACTCTCATTGCCAGTTGG + Intronic
982681521 4:158436538-158436560 CACATACTCTCACTCATAGGTGG + Intronic
982815796 4:159882783-159882805 CCCTTCCTCTCCCTCCTTTTCGG - Intergenic
984173391 4:176387362-176387384 CGCATATTCTCACTCATAGTTGG - Intergenic
985344158 4:188985446-188985468 GCCTGACACTCACTCCTACTGGG + Intergenic
986612584 5:9584394-9584416 CGCTTATTCTCACTCATAGGTGG - Intergenic
986619389 5:9655981-9656003 CCCTGACTCTCAATGCTAATAGG + Intronic
987983111 5:25113961-25113983 CGCATATTCTCACTCATAGTTGG - Intergenic
988022467 5:25638991-25639013 CGCATATTCTCACTCATAGTTGG - Intergenic
988970477 5:36462589-36462611 CTCTTACTCACTCTCCTACTAGG + Intergenic
989861159 5:46377156-46377178 CCCATATTCTCACTCATAGGTGG + Intergenic
991661968 5:68959556-68959578 CCCTTGTTCTCACTCATAGGTGG + Intergenic
992815503 5:80433353-80433375 CGCATATTCTCACTCGTAGTTGG + Intronic
994334887 5:98552454-98552476 CGCATATTCTCACTCATAGTTGG + Intergenic
995238421 5:109857513-109857535 CCCTTAGCCTCACTTCTAGGTGG + Intronic
995343391 5:111085105-111085127 CGCATATTCTCACTCCTAGGTGG - Intergenic
995598638 5:113773421-113773443 CCCTTGTTCTCACTCATAGGTGG - Intergenic
996978037 5:129459164-129459186 CCCTTACTCTTACTCCTTTTAGG + Intergenic
1001580897 5:172797492-172797514 CCCTCGCTCTCACTCCTTCTGGG - Intergenic
1004128960 6:12901039-12901061 CCCTTACCCTCTCCCCTAGGAGG - Intronic
1004477543 6:15987879-15987901 CCATTCCTCTCACTGCTAGAAGG + Intergenic
1005685186 6:28247045-28247067 CCCTGACCCTCACTCCTGGGTGG - Exonic
1009434950 6:63607097-63607119 CCCTGAGTCTCACAACTAGTAGG - Intergenic
1009445569 6:63738503-63738525 CCCATATTCTCACTCATAGGTGG + Intronic
1009869791 6:69439766-69439788 CGCATATTCTCACTCATAGTTGG - Intergenic
1011308249 6:85953128-85953150 CCCTTGTTCTCACTCATAGGTGG - Intergenic
1012701401 6:102461394-102461416 CGCATATTCTCACTCATAGTGGG + Intergenic
1017887908 6:158614711-158614733 CACATACTCTCACTCATAGGTGG - Intronic
1020651809 7:10885029-10885051 CGCATATTCTCACTCCTAGGTGG - Intergenic
1022536753 7:31103129-31103151 CCCTTATTCTCCCTCCAAGCTGG - Intronic
1024098993 7:46009926-46009948 CCCTTACCTTCACTCACAGTGGG + Intergenic
1027289941 7:76695940-76695962 CGCTTATTCTCACTCATAGGTGG + Intergenic
1027856563 7:83519196-83519218 CGCATATTCTCACTCATAGTTGG - Intronic
1029970349 7:104782427-104782449 CCCTTCCTCCCACTCAGAGTTGG - Intronic
1031774062 7:125884581-125884603 CGCATATTCTCACTCATAGTTGG + Intergenic
1034368700 7:150574703-150574725 CCCATATTCTCACTCATAGGTGG - Intergenic
1035436727 7:158865064-158865086 CCCTCACACCCACTCGTAGTGGG + Intronic
1037048055 8:14334446-14334468 CCAGTCCTCTCACTCTTAGTCGG + Intronic
1037166810 8:15840143-15840165 CGCATACTCTCACTCATAGGTGG + Intergenic
1037548219 8:19944427-19944449 CCTTTTCTCTCACTCCTACAGGG - Intronic
1038110471 8:24491460-24491482 CCCTTGCTTTCACTGCTAGAGGG - Intronic
1038672954 8:29597014-29597036 CCCTCTCTCTCACTCTTTGTGGG + Intergenic
1039245395 8:35602948-35602970 CCCATATTCTCACTCATAGATGG - Intronic
1039316934 8:36383943-36383965 CGCATATTCTCACTCCTAGGTGG - Intergenic
1039520804 8:38169795-38169817 CACTTACTATTTCTCCTAGTAGG + Exonic
1040143725 8:43960763-43960785 CGCATATTCTCACTCATAGTTGG + Intergenic
1040272429 8:45967992-45968014 CGCATATTCTCACTCATAGTTGG + Intergenic
1040368032 8:46740115-46740137 CGCATGCTCTCACTCCTAGGTGG - Intergenic
1041018497 8:53615282-53615304 CCCATATTCTCACTCATAGGTGG + Intergenic
1041209139 8:55529881-55529903 CCTTAACTCTAACTCATAGTAGG + Exonic
1042351789 8:67784330-67784352 CCCTTTGTCTCAATGCTAGTGGG - Intergenic
1043247431 8:78022643-78022665 CCTTTACCCTTACTCCTAATTGG + Intergenic
1044197223 8:89391848-89391870 CACATATTCTCACTCATAGTTGG + Intergenic
1044207633 8:89509829-89509851 CGCATATTCTCACTCATAGTTGG - Intergenic
1045969613 8:108064937-108064959 CCCATGTTCTCACTCATAGTTGG + Intronic
1047085219 8:121508242-121508264 CCCATATTCTCACTCATAGGTGG - Intergenic
1047748199 8:127860850-127860872 CCATTTCTCTCCCTCCTACTCGG + Intergenic
1047843683 8:128782665-128782687 CTCTTACACTCATTCCTATTAGG - Intergenic
1048412491 8:134189813-134189835 CGCATATTCTCACTCCTAGGTGG - Intergenic
1049026418 8:139993322-139993344 CCATTTCTCTAACTACTAGTTGG - Intronic
1049822798 8:144646274-144646296 CCCTTGTTCTCACTCCTGTTTGG - Intergenic
1051939463 9:22488008-22488030 CGCATACTCTCACTCATAGGTGG - Intergenic
1053699564 9:40675942-40675964 CGCATATTCTCACTCATAGTTGG - Intergenic
1054310853 9:63475343-63475365 CGCATATTCTCACTCATAGTTGG - Intergenic
1054409642 9:64799494-64799516 CGCATATTCTCACTCATAGTTGG - Intergenic
1057069974 9:92088989-92089011 TCCTGACTCTCACTCATGGTGGG - Intronic
1057710619 9:97439592-97439614 CCCTTACTCTCTCACCTCTTAGG + Intronic
1059422673 9:114202031-114202053 TCCTTGCTATCACTCCTAGGAGG - Intronic
1203732238 Un_GL000216v2:101080-101102 CCCTTGCTCTCATTCTTTGTTGG - Intergenic
1203403122 Un_KI270519v1:135286-135308 CACTTGTTCTCACTCATAGTTGG + Intergenic
1186188920 X:7050287-7050309 CCCTCCCTCTCACTCATAGGAGG + Exonic
1186644449 X:11491438-11491460 CGCATATTCTCACTCCTAGGTGG - Intronic
1188612462 X:32117245-32117267 CATTTGATCTCACTCCTAGTTGG + Intronic
1191008059 X:55731911-55731933 CTCTTCATCTCACTCCTAGTGGG - Intronic
1193386141 X:80873500-80873522 CTCTCTCTCTCTCTCCTAGTTGG + Intergenic
1194199667 X:90939082-90939104 CCCCTACCCTCACTCCCAATAGG + Intergenic
1194417652 X:93633237-93633259 CGCATACTCTCACTCCTAGGTGG + Intergenic
1195628599 X:107030301-107030323 CTCTGGGTCTCACTCCTAGTTGG + Intergenic
1196639038 X:118037510-118037532 CGCTTATTCTCACTCATAGGTGG + Intronic
1198015157 X:132602882-132602904 CCCTGACTCTCACTCCAGGATGG - Intergenic
1198621758 X:138520054-138520076 CCGTTCCTCTCAATCCTAGGTGG + Intergenic
1198771200 X:140132046-140132068 CGCATATTCTCACTCATAGTTGG + Intergenic
1199890441 X:152073677-152073699 CCCATATTCTCACTCATAGGTGG - Intergenic
1200545656 Y:4515499-4515521 CCCCTACCCTCACTCCCAATAGG + Intergenic
1201591197 Y:15616799-15616821 CGCATATTCTCACTCCTAGGTGG + Intergenic
1201928097 Y:19311954-19311976 CACATATTCTCACTCCTAGTTGG - Intergenic
1201970819 Y:19792621-19792643 CACATGCTCTCACTCATAGTGGG - Intergenic