ID: 1164706298

View in Genome Browser
Species Human (GRCh38)
Location 19:30322779-30322801
Sequence CCTTACTCTCACTCCTAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 119}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164706287_1164706298 -4 Left 1164706287 19:30322760-30322782 CCCTCCTGCCCACCGAGCCCCTT 0: 1
1: 0
2: 3
3: 37
4: 362
Right 1164706298 19:30322779-30322801 CCTTACTCTCACTCCTAGTGGGG 0: 1
1: 0
2: 1
3: 6
4: 119
1164706285_1164706298 9 Left 1164706285 19:30322747-30322769 CCTCCATTCACAGCCCTCCTGCC 0: 1
1: 0
2: 8
3: 44
4: 538
Right 1164706298 19:30322779-30322801 CCTTACTCTCACTCCTAGTGGGG 0: 1
1: 0
2: 1
3: 6
4: 119
1164706283_1164706298 28 Left 1164706283 19:30322728-30322750 CCATGAACTCTTCATGAGCCCTC 0: 1
1: 0
2: 0
3: 9
4: 157
Right 1164706298 19:30322779-30322801 CCTTACTCTCACTCCTAGTGGGG 0: 1
1: 0
2: 1
3: 6
4: 119
1164706286_1164706298 6 Left 1164706286 19:30322750-30322772 CCATTCACAGCCCTCCTGCCCAC 0: 1
1: 0
2: 5
3: 56
4: 536
Right 1164706298 19:30322779-30322801 CCTTACTCTCACTCCTAGTGGGG 0: 1
1: 0
2: 1
3: 6
4: 119
1164706288_1164706298 -5 Left 1164706288 19:30322761-30322783 CCTCCTGCCCACCGAGCCCCTTA No data
Right 1164706298 19:30322779-30322801 CCTTACTCTCACTCCTAGTGGGG 0: 1
1: 0
2: 1
3: 6
4: 119
1164706289_1164706298 -8 Left 1164706289 19:30322764-30322786 CCTGCCCACCGAGCCCCTTACTC 0: 1
1: 0
2: 1
3: 11
4: 213
Right 1164706298 19:30322779-30322801 CCTTACTCTCACTCCTAGTGGGG 0: 1
1: 0
2: 1
3: 6
4: 119
1164706284_1164706298 10 Left 1164706284 19:30322746-30322768 CCCTCCATTCACAGCCCTCCTGC 0: 1
1: 0
2: 3
3: 30
4: 428
Right 1164706298 19:30322779-30322801 CCTTACTCTCACTCCTAGTGGGG 0: 1
1: 0
2: 1
3: 6
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164706298 Original CRISPR CCTTACTCTCACTCCTAGTG GGG Intronic
902377671 1:16037461-16037483 CCTGTCTCCCAGTCCTAGTGTGG - Intergenic
904211757 1:28890523-28890545 CCCTACTCTCACTCCACGTGAGG + Intronic
904844135 1:33396099-33396121 CTTTACTGTCACACCTACTGAGG - Intronic
904898315 1:33835419-33835441 GCGTATTCTCACTCATAGTGGGG + Intronic
908266802 1:62387217-62387239 TCTTATTTTAACTCCTAGTGAGG - Intergenic
908379377 1:63581140-63581162 CCTTGCTCACAATCTTAGTGGGG + Intronic
914516964 1:148382558-148382580 CTTTGCCCTGACTCCTAGTGAGG - Intergenic
916481537 1:165218955-165218977 CATAAATCTGACTCCTAGTGGGG + Intronic
916710866 1:167406440-167406462 CCTAATTCTCAATCTTAGTGGGG - Intronic
916869344 1:168895549-168895571 CATTGCTCTCACTGCTAGAGAGG + Intergenic
918020354 1:180681695-180681717 CCTTACTCTCTCTCCCAGGCTGG + Intronic
918140340 1:181714527-181714549 CCCTACTCCCACTTCTAGGGAGG - Intronic
922563823 1:226588315-226588337 CCTTCCTCTCCCACCTAGTGTGG + Intronic
1063989642 10:11546229-11546251 CCTTTCTCTCACTGCTGGTATGG - Intronic
1065449302 10:25839531-25839553 CCACTCTCTCACTCCAAGTGGGG + Intergenic
1066150353 10:32609803-32609825 CCTATCTCTCACTCCTACTCTGG + Intronic
1067681016 10:48441089-48441111 CCTTCCTCCCACTCCTGGAGCGG - Intergenic
1068073264 10:52222491-52222513 CCATATTCTCACTCCTGGTTGGG - Intronic
1073689011 10:105786872-105786894 CCTTTCTATCACACCTACTGAGG + Intergenic
1074460688 10:113634465-113634487 CCTTTCTCTCATTAATAGTGTGG - Intronic
1080783672 11:35454657-35454679 CCTCAGTCTCACTCCTGGAGGGG + Intronic
1083724442 11:64620962-64620984 CCTTACACTCACTCATCTTGGGG - Intronic
1083838067 11:65285543-65285565 TCTCACTCTCACTCCTAGGCTGG - Intronic
1086255169 11:84867312-84867334 CCATACTCCCACTCTGAGTGAGG - Intronic
1086983285 11:93221918-93221940 TGTTACTCTCACACCCAGTGTGG + Intergenic
1091079164 11:132650187-132650209 CCTTACTAACACTGCTAGTTAGG - Intronic
1095968836 12:47887582-47887604 CCTTACTCACTCTTCTTGTGGGG - Intronic
1097901642 12:64879577-64879599 CCTTTCTATGACTTCTAGTGTGG + Intronic
1102852290 12:116260132-116260154 CTTTACTTTCTCTCCAAGTGAGG - Intronic
1112807706 13:103181174-103181196 CTTTACTGTCACACTTAGTGGGG + Intergenic
1116583303 14:46670297-46670319 TCTCACTCTCCCTGCTAGTGAGG - Intergenic
1120372893 14:83660750-83660772 CCTTAGATTCACTCCTAGTCGGG + Intergenic
1121128560 14:91425290-91425312 CCTTACTGTGAGTCCTAGTAAGG - Intergenic
1125163668 15:36677685-36677707 CCTTCCTCTCCCTCATATTGTGG - Intronic
1125336746 15:38634283-38634305 GCTTACTCTCACTAGTAGTCAGG + Intergenic
1128604653 15:69027808-69027830 CCTTGCGCTCACCCCAAGTGGGG + Intronic
1130159446 15:81384123-81384145 CCTTCCTCTCTCTGCTTGTGAGG + Intergenic
1130952942 15:88606271-88606293 CCTTTCACTCACTCCTATTAAGG - Intergenic
1140772894 16:78222303-78222325 CCAAACTCTCACCCCTAATGAGG - Intronic
1140839783 16:78827918-78827940 CCTTACTCTGACTCCTAATGAGG - Intronic
1142894842 17:2967464-2967486 GCTCACTCTCACTCCTAAAGAGG - Intronic
1143891838 17:10107973-10107995 CCTTACACACAGTCCCAGTGGGG + Intronic
1150660574 17:67072648-67072670 CCTCACTCTCACCCCTGCTGGGG - Exonic
1152151104 17:78601856-78601878 CCTTTCTCTGATTCCTAGTAAGG + Intergenic
1152379511 17:79935048-79935070 CCTAACTCCCACTCCTAGGAAGG + Exonic
1155577684 18:27265726-27265748 CCTTATTCACACTCTTACTGAGG - Intergenic
1159184050 18:64947204-64947226 CCTGTCTCTCACACCTATTGGGG - Intergenic
1159393151 18:67821399-67821421 CCTTTCTCTCATTTCTAGTCAGG + Intergenic
1163530038 19:17843535-17843557 CCATAATGTCACTCCTACTGAGG - Intronic
1164706298 19:30322779-30322801 CCTTACTCTCACTCCTAGTGGGG + Intronic
1165741225 19:38206383-38206405 CCTGACTCACAGCCCTAGTGAGG - Exonic
1168498722 19:56875679-56875701 CCTTACTCCTACTCAGAGTGGGG - Intergenic
927027830 2:19088195-19088217 CCTTTCCCTCAATACTAGTGAGG + Intergenic
928087669 2:28355988-28356010 CCTTGCTCTCCCTCCTGTTGTGG - Intergenic
928845255 2:35663704-35663726 CCTTAATGTCACTCCTCATGTGG + Intergenic
929449319 2:42026099-42026121 CCTTACTCTCACCCCAAATCCGG + Intergenic
931021256 2:58047053-58047075 CCTTGTTCTCACTCCCAGCGGGG - Intronic
937035126 2:118774678-118774700 CCTCGCTCTGACTCCTATTGCGG + Intergenic
939563810 2:143763119-143763141 CCATAATTTCACTCCTACTGTGG - Intronic
939850128 2:147294364-147294386 ACTTGCTCTCACTCTCAGTGAGG + Intergenic
941042276 2:160635862-160635884 CCAGCCTCTCACTCCTAGAGTGG + Intergenic
941264826 2:163348387-163348409 CCCTACTCTGACTCCTGGCGCGG + Intergenic
941695632 2:168548294-168548316 CCTTCCTCCCACTCCTAGTTTGG - Intronic
942222464 2:173784050-173784072 CCTGTCTCTCACTCCAACTGTGG - Intergenic
944208685 2:197184248-197184270 CCTTACTCTCCCTCGTAGCTAGG + Intronic
944474035 2:200085652-200085674 TCTTACTCTTACTCCTTGTTAGG + Intergenic
1172188483 20:33047509-33047531 ACTCCCTCTCACTCGTAGTGGGG + Intergenic
1173317340 20:41957048-41957070 CCGTGCCCTCACTCTTAGTGTGG + Intergenic
1175529421 20:59664213-59664235 CCTTACACTCACTCCTTTTGTGG - Intronic
1178370293 21:32021616-32021638 CTTCATTCTCACTCCTGGTGCGG - Intronic
1178791889 21:35707893-35707915 CCTTAATCTCACTCCTCAGGTGG - Intronic
1182554205 22:31120254-31120276 CCTTGCCCTCACTCTTGGTGGGG - Intergenic
1183133500 22:35863567-35863589 CCTGACTCTCATACCTACTGGGG + Intronic
1185167279 22:49269465-49269487 CCTTATTCTCACTCATAGGTGGG - Intergenic
949942972 3:9168916-9168938 CCTTTCTCTAACTCCTGGAGAGG - Intronic
951440418 3:22716515-22716537 CCTTACTATCACTAATATTGTGG - Intergenic
955225932 3:57060470-57060492 CCTGATTCTGACTCCTACTGTGG - Exonic
957038411 3:75316368-75316390 CCTTAATCTCATTCATAATGAGG + Intergenic
961398344 3:126614819-126614841 CCTCCCTCTCCCTCCTAGTTGGG + Intronic
962927290 3:140006732-140006754 CAATACTCTCAATCGTAGTGAGG - Intronic
966007492 3:175033761-175033783 CTTTACTCTCACTCCTTACGTGG + Intronic
972048184 4:34694939-34694961 TCTTGCTCTCTCTCCTAGTCTGG - Intergenic
978495193 4:109351548-109351570 CCTCACTCTCTCTCCCAGTCTGG - Intergenic
978501756 4:109417536-109417558 CCTGACTCTCAGCCTTAGTGGGG - Intergenic
980420274 4:132549647-132549669 CCTTATTCTAAATCCTAGTAGGG - Intergenic
985350808 4:189059060-189059082 CCTTACGCACATTCCTATTGAGG - Intergenic
994510237 5:100693868-100693890 CCTTACTCTTACTGGTAATGTGG - Intergenic
1001436871 5:171705983-171706005 CCTTAGTCTCAGCCCTACTGGGG - Intergenic
1003243500 6:4365063-4365085 TGTTACTCTTACCCCTAGTGGGG + Intergenic
1003608502 6:7587448-7587470 CCTTACTCCCTCTCCTAATTTGG + Intergenic
1004100928 6:12610701-12610723 CCTTGCTCTCTCTCCTAGGCTGG + Intergenic
1004326082 6:14675116-14675138 CCTAACAGTAACTCCTAGTGAGG + Intergenic
1006276287 6:33007641-33007663 CCTTAATCCCAGTCCTAGTAAGG - Intronic
1006371351 6:33645766-33645788 CATTTCTCTGACTACTAGTGAGG + Intronic
1006567540 6:34973327-34973349 CCTTAGTCTCCCTCCCTGTGAGG + Intronic
1006746883 6:36349032-36349054 CCCTACTCCCACTCCAAGTTAGG + Intergenic
1014771274 6:125460006-125460028 CCTCACTCTCACTCCTGCTCTGG - Intergenic
1015366678 6:132403294-132403316 CCCTACTTTTATTCCTAGTGTGG + Intergenic
1015630752 6:135229719-135229741 CCTAAATCTGACTCCTGGTGAGG - Intergenic
1015848840 6:137551011-137551033 TCTCTCTCTCTCTCCTAGTGTGG - Intergenic
1016463783 6:144306164-144306186 CCTCTCTCTCACTCCTGGTTTGG + Intronic
1018268553 6:162051712-162051734 CCTTCCTCTCCATCCTGGTGGGG + Intronic
1018437788 6:163778360-163778382 CATTACTGTCACTCCAAATGGGG - Intergenic
1029012844 7:97280831-97280853 TCTCACTCTCTCTCCTAGAGAGG - Intergenic
1029303929 7:99604964-99604986 CCTCACTCTCACTCCCAGGCTGG - Intronic
1030272831 7:107687985-107688007 CCTTACTCTCCCTACCAGTGAGG - Intronic
1034078697 7:148257092-148257114 CCTGACTCTCACACCTGGGGAGG - Intronic
1035079491 7:156204203-156204225 CATTGCTCTCACTCCTAGGAAGG + Intergenic
1035436729 7:158865065-158865087 CCTCACACCCACTCGTAGTGGGG + Intronic
1038631387 8:29247802-29247824 TCTTACTCTCACACCTAGGCTGG - Intronic
1042351787 8:67784329-67784351 CCTTTGTCTCAATGCTAGTGGGG - Intergenic
1045013815 8:97981598-97981620 CCTTCCTCTAACTCCTGCTGTGG - Intronic
1049234564 8:141506051-141506073 CCTCACTCCCACTCCCAGAGTGG - Intergenic
1049797705 8:144504124-144504146 CCTTTCTGTCCCTCCCAGTGAGG + Exonic
1050517916 9:6464173-6464195 CAATTCTCTGACTCCTAGTGGGG + Intronic
1057069972 9:92088988-92089010 CCTGACTCTCACTCATGGTGGGG - Intronic
1057186083 9:93058399-93058421 TCTCACCTTCACTCCTAGTGTGG - Intergenic
1060271620 9:122146864-122146886 TCTTACTCTCTCTCCTAGGCTGG - Intronic
1188142235 X:26565760-26565782 CCTTTCTCTACCTCCAAGTGAGG - Intergenic
1191032554 X:55990522-55990544 TCTTAATCTCACTGCTGGTGAGG + Intergenic
1191791867 X:64979550-64979572 CCTTCCTCTCACTGCTAGCCTGG - Intronic
1192134436 X:68583618-68583640 ACTCACTCTGACTCCAAGTGAGG + Intergenic
1192167592 X:68835419-68835441 CCTTACTCCTACTCCTAATCTGG + Intronic
1194417653 X:93633238-93633260 GCATACTCTCACTCCTAGGTGGG + Intergenic
1198948104 X:142038180-142038202 CCTTTCTCTCACTTCTTGTAAGG + Intergenic
1201928096 Y:19311953-19311975 ACATATTCTCACTCCTAGTTGGG - Intergenic
1201970818 Y:19792620-19792642 ACATGCTCTCACTCATAGTGGGG - Intergenic