ID: 1164706299

View in Genome Browser
Species Human (GRCh38)
Location 19:30322780-30322802
Sequence CTTACTCTCACTCCTAGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 90}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164706284_1164706299 11 Left 1164706284 19:30322746-30322768 CCCTCCATTCACAGCCCTCCTGC 0: 1
1: 0
2: 3
3: 30
4: 428
Right 1164706299 19:30322780-30322802 CTTACTCTCACTCCTAGTGGGGG 0: 1
1: 0
2: 1
3: 8
4: 90
1164706283_1164706299 29 Left 1164706283 19:30322728-30322750 CCATGAACTCTTCATGAGCCCTC 0: 1
1: 0
2: 0
3: 9
4: 157
Right 1164706299 19:30322780-30322802 CTTACTCTCACTCCTAGTGGGGG 0: 1
1: 0
2: 1
3: 8
4: 90
1164706288_1164706299 -4 Left 1164706288 19:30322761-30322783 CCTCCTGCCCACCGAGCCCCTTA No data
Right 1164706299 19:30322780-30322802 CTTACTCTCACTCCTAGTGGGGG 0: 1
1: 0
2: 1
3: 8
4: 90
1164706287_1164706299 -3 Left 1164706287 19:30322760-30322782 CCCTCCTGCCCACCGAGCCCCTT 0: 1
1: 0
2: 3
3: 37
4: 362
Right 1164706299 19:30322780-30322802 CTTACTCTCACTCCTAGTGGGGG 0: 1
1: 0
2: 1
3: 8
4: 90
1164706289_1164706299 -7 Left 1164706289 19:30322764-30322786 CCTGCCCACCGAGCCCCTTACTC 0: 1
1: 0
2: 1
3: 11
4: 213
Right 1164706299 19:30322780-30322802 CTTACTCTCACTCCTAGTGGGGG 0: 1
1: 0
2: 1
3: 8
4: 90
1164706286_1164706299 7 Left 1164706286 19:30322750-30322772 CCATTCACAGCCCTCCTGCCCAC 0: 1
1: 0
2: 5
3: 56
4: 536
Right 1164706299 19:30322780-30322802 CTTACTCTCACTCCTAGTGGGGG 0: 1
1: 0
2: 1
3: 8
4: 90
1164706285_1164706299 10 Left 1164706285 19:30322747-30322769 CCTCCATTCACAGCCCTCCTGCC 0: 1
1: 0
2: 8
3: 44
4: 538
Right 1164706299 19:30322780-30322802 CTTACTCTCACTCCTAGTGGGGG 0: 1
1: 0
2: 1
3: 8
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164706299 Original CRISPR CTTACTCTCACTCCTAGTGG GGG Intronic
903479045 1:23639810-23639832 CTGAGTCTCCCTCCTAGAGGTGG + Intronic
903998728 1:27325024-27325046 CTTTCTCTCCCTCCTGCTGGAGG - Intronic
904211759 1:28890524-28890546 CCTACTCTCACTCCACGTGAGGG + Intronic
908207824 1:61869465-61869487 CTTACTCTCAATCTTCCTGGGGG + Intronic
908266801 1:62387216-62387238 CTTATTTTAACTCCTAGTGAGGG - Intergenic
909971117 1:81990952-81990974 CTCATTCTCACTCCTCCTGGAGG - Exonic
911551953 1:99293113-99293135 CTTACCCCCACTCCACGTGGCGG - Intronic
914839203 1:151233819-151233841 CTTACTCTGATTGCTATTGGAGG + Intronic
921420277 1:214939251-214939273 CTTGCTGTCACTCCTGGTGCTGG - Intergenic
924280319 1:242430592-242430614 CTTACTCCTACTCCTAGTGGTGG + Intronic
1068073263 10:52222490-52222512 CATATTCTCACTCCTGGTTGGGG - Intronic
1069604809 10:69732423-69732445 CTCACTCTCAGTCCTCCTGGGGG - Intergenic
1070493222 10:76996761-76996783 CTTTTTCTCACTGGTAGTGGTGG + Intronic
1074459203 10:113621554-113621576 CTTTGTGTCATTCCTAGTGGTGG - Intronic
1079603370 11:22338378-22338400 CTCACTCTCACTCTTGCTGGAGG + Exonic
1082730047 11:56785052-56785074 TTTTCTCTCTCTCCTAGTGTTGG - Intergenic
1084276063 11:68051514-68051536 CTTCCTCTGCCTCCCAGTGGGGG - Intergenic
1086983286 11:93221919-93221941 GTTACTCTCACACCCAGTGTGGG + Intergenic
1088897995 11:114092317-114092339 CTTGCTCACAATCCTAGAGGCGG - Intronic
1091366869 11:135029658-135029680 CTTAGTCTCACTGCTGATGGTGG + Intergenic
1091366881 11:135029736-135029758 CTTAGTCTCACTGCTGATGGTGG + Intergenic
1093293051 12:17352905-17352927 TTTACCATCACTCCTAATGGAGG + Intergenic
1093547998 12:20369836-20369858 CTTACTCTCACTCCCCGCCGCGG + Exonic
1093787661 12:23211467-23211489 CTTACTCACAGTCCTAGAGGTGG - Intergenic
1093924993 12:24901269-24901291 CCTACCCTCCCTCCTCGTGGAGG - Intronic
1094622326 12:32091764-32091786 CTTTCTCTCATTGCTGGTGGAGG - Intergenic
1098258821 12:68646656-68646678 CCCACTCTCACTCCCAGTGGAGG + Intronic
1099781351 12:87199915-87199937 CTTATTCTCTCTGCTAGTGGTGG - Intergenic
1105330584 13:19412001-19412023 CTTACTGTCCCTGCTAGTGTTGG + Intergenic
1105981304 13:25519080-25519102 TTTACTCTCCCTCCTACAGGTGG + Intronic
1107482133 13:40793999-40794021 CTTACTGTCCCTGCTAGTGTTGG + Intronic
1115531033 14:34327418-34327440 ATTACTCTCATTCTCAGTGGTGG + Intronic
1117989148 14:61416694-61416716 CTTACTATCACTCTTGGGGGAGG - Intronic
1119287181 14:73464968-73464990 CTTTCTCTCATTCTTAGTTGAGG - Intergenic
1121124480 14:91397281-91397303 CTTGCTTTCACTCCTGGTGTTGG - Intronic
1123068551 14:105630019-105630041 CTGACTCTCACTCATGGTGGAGG + Intergenic
1123098134 14:105776045-105776067 CTGACTCTCACTCATGGTGCAGG + Intergenic
1125001396 15:34774071-34774093 CTTTCTCTCCTTCCCAGTGGTGG - Intergenic
1125336747 15:38634284-38634306 CTTACTCTCACTAGTAGTCAGGG + Intergenic
1127958584 15:63873894-63873916 CTTGCTCTTCCTCCTAGTTGGGG - Intergenic
1127962330 15:63899002-63899024 CTTACTCAAACTCCAAGAGGAGG - Intergenic
1133874620 16:9722210-9722232 CTCACTCACATGCCTAGTGGTGG + Intergenic
1134396831 16:13873085-13873107 CATTTTCTCACCCCTAGTGGTGG + Intergenic
1143891839 17:10107974-10107996 CTTACACACAGTCCCAGTGGGGG + Intronic
1150117507 17:62566805-62566827 CTTACACTGACTTCTAGTAGTGG + Intronic
1150621046 17:66807891-66807913 CTTCCTCTCCCTCCTACTGCAGG - Exonic
1155908758 18:31485002-31485024 CTAATTCTCACTCCAAGTAGAGG - Intergenic
1163797068 19:19343820-19343842 CTGACTCTCACCCATAGTGCTGG + Exonic
1164706299 19:30322780-30322802 CTTACTCTCACTCCTAGTGGGGG + Intronic
1164736643 19:30545989-30546011 CTTGCTCTCACTCGTAGGGCAGG + Intronic
926633159 2:15156005-15156027 CATACTCTCTTTCATAGTGGTGG + Intergenic
927632047 2:24783095-24783117 CTTACTCTTCCTCCTCATGGAGG + Intergenic
932465804 2:71923364-71923386 CTTACTCCAACTCCTTCTGGAGG - Intergenic
937516077 2:122656781-122656803 CTTACTCTCTGACCTAGTGGAGG - Intergenic
938591748 2:132745520-132745542 CATGCTCTCAGTCTTAGTGGGGG - Intronic
941695631 2:168548293-168548315 CTTCCTCCCACTCCTAGTTTGGG - Intronic
943084090 2:183291427-183291449 CTTAATCTTTCTGCTAGTGGAGG - Intergenic
944980466 2:205113260-205113282 CTTACTTTTACTCCTAGAAGAGG - Intronic
1169553623 20:6726758-6726780 TTTATTCTCACTCCTGGTGCAGG - Intergenic
1169725617 20:8726293-8726315 CTTTCTCTCACTCTAATTGGAGG + Intronic
1176742428 21:10616625-10616647 CTTACTGTCCCTGCTAGTGTTGG - Intergenic
1180564307 22:16649835-16649857 CTTACTGTCCCTGCTAGTGTTGG - Intergenic
1182554204 22:31120253-31120275 CTTGCCCTCACTCTTGGTGGGGG - Intergenic
950682132 3:14592689-14592711 CTTCCCCTGACTCCTTGTGGTGG + Intergenic
951428764 3:22581906-22581928 CTGACCCTCATTCTTAGTGGAGG + Intergenic
953926391 3:46984799-46984821 CTTACTGTCACTCACAGAGGGGG + Intronic
959470270 3:106741407-106741429 CTTTTTCTGAATCCTAGTGGTGG - Intergenic
960859423 3:122136510-122136532 TTTAATTTCACACCTAGTGGAGG - Intergenic
966768087 3:183480102-183480124 CTTAGTTACACTCCTAGTGATGG - Intergenic
974886686 4:67827446-67827468 CTTACTCTCATTCTTAGTTTAGG + Exonic
975672184 4:76791664-76791686 TATGCTCTCACTCATAGTGGAGG + Intergenic
977882092 4:102216764-102216786 CTTACTCTCACTTTTATTTGGGG + Intergenic
981047293 4:140276948-140276970 ATTACTCTCTCTCCTCATGGAGG + Intronic
986051020 5:4090352-4090374 CCTCATCTCACTCCAAGTGGTGG + Intergenic
986706358 5:10457587-10457609 ATTATTCTCACTCCCAGAGGAGG + Intronic
993595140 5:89844817-89844839 CTTACTCTGCCTCATTGTGGAGG - Intergenic
995886961 5:116905982-116906004 CTTCCTTTCACTCTAAGTGGAGG - Intergenic
998387058 5:141763433-141763455 CTGCCTCTCACTCCTTGGGGAGG + Intergenic
1003243501 6:4365064-4365086 GTTACTCTTACCCCTAGTGGGGG + Intergenic
1004291270 6:14369617-14369639 CTTACTGTCCCCTCTAGTGGAGG + Intergenic
1005229388 6:23683155-23683177 CCAACTCTCCCTCCTTGTGGAGG - Intergenic
1006008023 6:31018432-31018454 CTTACTCTCACCCCCAATGGAGG + Intronic
1010115838 6:72309242-72309264 TTTACTATGACTACTAGTGGTGG - Intronic
1014659363 6:124148915-124148937 CTTACTCTCAATGCTGTTGGTGG - Intronic
1015848839 6:137551010-137551032 CTCTCTCTCTCTCCTAGTGTGGG - Intergenic
1016627062 6:146183783-146183805 CTTAGTCTGACTCCTAATGTTGG + Intronic
1017016284 6:150102487-150102509 CTTACTTTAAATCCTGGTGGTGG - Intergenic
1018437787 6:163778359-163778381 ATTACTGTCACTCCAAATGGGGG - Intergenic
1032610411 7:133406849-133406871 CTCACTCTCTGTCCAAGTGGAGG - Intronic
1034474417 7:151274416-151274438 CTTCCTCTCACTCCTTGAGGAGG + Intronic
1035436730 7:158865066-158865088 CTCACACCCACTCGTAGTGGGGG + Intronic
1040933395 8:52758683-52758705 CGTGCTCTCACTCACAGTGGGGG + Intergenic
1043039254 8:75240342-75240364 CACACTCTGACTCCTAGTTGGGG + Intergenic
1043496863 8:80810954-80810976 CTCACTCACACTGCTAGGGGTGG - Intronic
1048113331 8:131491655-131491677 CTTACTCTTACCCAAAGTGGTGG - Intergenic
1059091383 9:111362413-111362435 CTTACTCCCACTGATACTGGGGG - Intronic
1059253749 9:112910164-112910186 CTTACTGTCTCCCCTGGTGGAGG - Intergenic
1061763730 9:132868538-132868560 CTTGTTCTCACTCCCTGTGGAGG + Intronic
1186353723 X:8768107-8768129 CTTAAACTCACTCCTTGTGTCGG - Intergenic
1196988250 X:121298680-121298702 CTTACTCTGACTCAGACTGGTGG + Intergenic