ID: 1164706300

View in Genome Browser
Species Human (GRCh38)
Location 19:30322790-30322812
Sequence CTCCTAGTGGGGGCCTCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 163}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164706292_1164706300 -5 Left 1164706292 19:30322772-30322794 CCGAGCCCCTTACTCTCACTCCT 0: 1
1: 0
2: 2
3: 40
4: 470
Right 1164706300 19:30322790-30322812 CTCCTAGTGGGGGCCTCAGATGG 0: 1
1: 0
2: 2
3: 14
4: 163
1164706288_1164706300 6 Left 1164706288 19:30322761-30322783 CCTCCTGCCCACCGAGCCCCTTA No data
Right 1164706300 19:30322790-30322812 CTCCTAGTGGGGGCCTCAGATGG 0: 1
1: 0
2: 2
3: 14
4: 163
1164706290_1164706300 -1 Left 1164706290 19:30322768-30322790 CCCACCGAGCCCCTTACTCTCAC 0: 1
1: 0
2: 1
3: 5
4: 108
Right 1164706300 19:30322790-30322812 CTCCTAGTGGGGGCCTCAGATGG 0: 1
1: 0
2: 2
3: 14
4: 163
1164706293_1164706300 -10 Left 1164706293 19:30322777-30322799 CCCCTTACTCTCACTCCTAGTGG 0: 1
1: 0
2: 2
3: 28
4: 298
Right 1164706300 19:30322790-30322812 CTCCTAGTGGGGGCCTCAGATGG 0: 1
1: 0
2: 2
3: 14
4: 163
1164706289_1164706300 3 Left 1164706289 19:30322764-30322786 CCTGCCCACCGAGCCCCTTACTC 0: 1
1: 0
2: 1
3: 11
4: 213
Right 1164706300 19:30322790-30322812 CTCCTAGTGGGGGCCTCAGATGG 0: 1
1: 0
2: 2
3: 14
4: 163
1164706284_1164706300 21 Left 1164706284 19:30322746-30322768 CCCTCCATTCACAGCCCTCCTGC 0: 1
1: 0
2: 3
3: 30
4: 428
Right 1164706300 19:30322790-30322812 CTCCTAGTGGGGGCCTCAGATGG 0: 1
1: 0
2: 2
3: 14
4: 163
1164706286_1164706300 17 Left 1164706286 19:30322750-30322772 CCATTCACAGCCCTCCTGCCCAC 0: 1
1: 0
2: 5
3: 56
4: 536
Right 1164706300 19:30322790-30322812 CTCCTAGTGGGGGCCTCAGATGG 0: 1
1: 0
2: 2
3: 14
4: 163
1164706287_1164706300 7 Left 1164706287 19:30322760-30322782 CCCTCCTGCCCACCGAGCCCCTT 0: 1
1: 0
2: 3
3: 37
4: 362
Right 1164706300 19:30322790-30322812 CTCCTAGTGGGGGCCTCAGATGG 0: 1
1: 0
2: 2
3: 14
4: 163
1164706291_1164706300 -2 Left 1164706291 19:30322769-30322791 CCACCGAGCCCCTTACTCTCACT 0: 1
1: 0
2: 4
3: 10
4: 191
Right 1164706300 19:30322790-30322812 CTCCTAGTGGGGGCCTCAGATGG 0: 1
1: 0
2: 2
3: 14
4: 163
1164706285_1164706300 20 Left 1164706285 19:30322747-30322769 CCTCCATTCACAGCCCTCCTGCC 0: 1
1: 0
2: 8
3: 44
4: 538
Right 1164706300 19:30322790-30322812 CTCCTAGTGGGGGCCTCAGATGG 0: 1
1: 0
2: 2
3: 14
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164706300 Original CRISPR CTCCTAGTGGGGGCCTCAGA TGG Intronic
900079332 1:843842-843864 CTCAGAGTAGGGGCCTCAGAGGG - Intergenic
900472560 1:2861976-2861998 CTCCTCCTGGGGGCCGCAGGCGG - Intergenic
900662089 1:3789839-3789861 CACCCAGTGGCGGCCTCAGCAGG + Intronic
901139683 1:7020627-7020649 CTCCTACAGGAGCCCTCAGAGGG - Intronic
901594816 1:10376454-10376476 CTCCAGGAGGGAGCCTCAGAGGG + Intronic
902641334 1:17768221-17768243 ATCCTGGTGGGGTCCCCAGAGGG - Intronic
904200537 1:28816549-28816571 CTCATCCTGGGGGCCTGAGAGGG + Intronic
904887550 1:33752445-33752467 CTCCTGGTGAGGGTCTCAGGAGG - Intronic
906516059 1:46439514-46439536 ATCCTAGAGGGGGGCTGAGAGGG - Intergenic
906762892 1:48393794-48393816 CTTCTAGTTGGGTCCTCAAATGG + Intronic
908953364 1:69589695-69589717 ATCCTAGTGGGTGCCTAATAAGG - Intronic
915141141 1:153769354-153769376 ATCCCAGTGCAGGCCTCAGAAGG - Intronic
915544375 1:156587949-156587971 CTCCTAGTGGGAGGCTGAGGTGG - Intergenic
916655593 1:166872736-166872758 CTTCTGGTGAGGGCCTCAGGTGG - Intronic
920257559 1:204665846-204665868 CACTCAGTGGGGGCCTCAGGAGG - Intronic
924414293 1:243843179-243843201 CTCCAAGTTGGGGGCTCAGAGGG - Exonic
1065021867 10:21508353-21508375 CTCCCAGTTGGGACCTGAGAAGG - Intergenic
1066287863 10:33985963-33985985 CTCCTAGTTGGGGCTTCGGTTGG - Intergenic
1068340788 10:55699532-55699554 CTTCTGGTGAGGGCCTCAGGAGG - Intergenic
1070699698 10:78592585-78592607 CTCCTTGTGGGGGCATAAAATGG - Intergenic
1071509148 10:86250500-86250522 CTCCCAGTGGGGCACTCAGCAGG + Intronic
1073115449 10:101089113-101089135 CTAGTAGTGGGGGCCTTGGAGGG + Intergenic
1075957390 10:126535847-126535869 CTCCTAGCGTGGGCCTGAGCTGG - Intronic
1076291511 10:129349317-129349339 CCCCCAGTGGGTGTCTCAGAAGG + Intergenic
1076313650 10:129525880-129525902 CTCCTGGTGGGGGCCTAACACGG - Intronic
1077308940 11:1880067-1880089 GGCCTAGTGGGGGACACAGAGGG - Exonic
1079623981 11:22593294-22593316 CTCATAGACGGGGCCTCACATGG - Intergenic
1080934613 11:36849376-36849398 CTTCTAGTTAGGGCCTTAGAAGG + Intergenic
1081531129 11:43959988-43960010 CTCCTGGTGGGGGCCGGAGCAGG - Intergenic
1081775687 11:45674694-45674716 GGCCGAGTGGGGGCTTCAGAGGG - Intergenic
1083572186 11:63766743-63766765 CTCCTGGCGGGGGCCCCAGGTGG - Intronic
1083956228 11:65984343-65984365 CTGCTAGTGGTGGCCGCAGATGG - Intergenic
1086752262 11:90512031-90512053 CTCCTAGTTTGAGCCTTAGAGGG + Intergenic
1093934519 12:24986589-24986611 CTCCAAGAGGAGGCCTCATAGGG - Intergenic
1097449133 12:59714491-59714513 CTCCTAGTTGTGTCCTCACATGG + Intronic
1097874841 12:64633522-64633544 CTCCTGGTGAGGACCTCAGGAGG - Intronic
1098628482 12:72700992-72701014 CTCCTACTGGGTCCCTCACATGG + Intergenic
1102630497 12:114274614-114274636 CTTCTGGTGGGGGCCTCGGGGGG + Intergenic
1103985967 12:124767693-124767715 CTCCCTGTGGGGGCTGCAGAGGG - Intergenic
1105004035 12:132710271-132710293 CGCCTAGCAGGGTCCTCAGAGGG - Intergenic
1106172163 13:27297491-27297513 ACCCCAGTGGGGGCCTCACAGGG - Intergenic
1108328151 13:49355632-49355654 CACCTAGAAGGGGCCACAGATGG + Intronic
1117247634 14:53901588-53901610 GACGTAGTGGGTGCCTCAGAAGG - Intergenic
1117615945 14:57533801-57533823 CTCACAGTGGGGACATCAGAGGG - Intergenic
1123118012 14:105903417-105903439 CTCCAAATAGGGGCTTCAGAGGG - Intergenic
1125765597 15:42133522-42133544 CTTCTGGTGAGGGCCTCAGACGG + Intergenic
1126066581 15:44830524-44830546 CTCCTGCTGTGAGCCTCAGAAGG + Intergenic
1126093301 15:45070345-45070367 CTCCTGCTGTGAGCCTCAGAAGG - Intronic
1128568213 15:68715052-68715074 CTCCTAGTGGGTGCACCACAGGG - Intronic
1128976673 15:72159387-72159409 CTACTAGAGGGGGCATCACAGGG + Intergenic
1129262115 15:74374330-74374352 CTCCTGGTGGGGGCCGCAGCTGG + Intergenic
1129666896 15:77584429-77584451 GTCTCACTGGGGGCCTCAGAGGG - Intergenic
1129791500 15:78343649-78343671 CCCCCAGAGGGGGCCCCAGATGG + Intronic
1132681589 16:1144653-1144675 GTGCCAGTGGCGGCCTCAGAGGG - Intergenic
1133448712 16:5885381-5885403 CTTCCTTTGGGGGCCTCAGATGG - Intergenic
1136690338 16:32024159-32024181 CTCGGAGTGGGGTCCCCAGAGGG - Intergenic
1136790927 16:32967723-32967745 CTCGGAGTGGGGTCCCCAGAGGG - Intergenic
1139426786 16:66885500-66885522 TTCCTTGTGCTGGCCTCAGATGG + Exonic
1139641884 16:68297510-68297532 CTCAAGGTGGGGGCTTCAGAGGG + Exonic
1141770320 16:86085810-86085832 CTCCTAGGGGGTGGCTGAGACGG + Intergenic
1141926827 16:87175286-87175308 GACCTACTGGGGGCCTCTGAGGG + Intronic
1142106951 16:88309414-88309436 CACCGAGAGGGGACCTCAGAGGG - Intergenic
1142106963 16:88309462-88309484 CACCGAGAGGGGACCTCAGAGGG - Intergenic
1142106990 16:88309558-88309580 CACCGAGAGGGGACCTCAGAGGG - Intergenic
1144716268 17:17437893-17437915 CTCCTATGTGGGGGCTCAGAAGG + Intergenic
1144801155 17:17928553-17928575 CTCTCAGTGAGGGCCCCAGACGG + Intronic
1146624485 17:34425070-34425092 CTCCTGGAGGGGGAGTCAGAAGG + Intergenic
1147916808 17:43892651-43892673 CTCATACTGGGGGTCTCAGAGGG + Intronic
1148551551 17:48553359-48553381 CTCCATGTGGGGGCCCCACAGGG - Exonic
1149604941 17:57917880-57917902 TTCCTAGTGGAGGCATCACAAGG - Intronic
1151591599 17:75047727-75047749 CTACTCGCAGGGGCCTCAGAGGG + Intronic
1152070007 17:78129683-78129705 CTGCCAGTGTGGTCCTCAGATGG + Intronic
1152383494 17:79954768-79954790 CACCCAGTGGGGCCATCAGAGGG + Intronic
1152786728 17:82252086-82252108 CTCCTGGAGGGGGCCAGAGAGGG + Intronic
1153892716 18:9533046-9533068 TTCCCTGTGGGGGCCTCACAGGG + Intronic
1154439374 18:14374062-14374084 CTCTGAGTTGGGGCCTCAGTAGG + Intergenic
1157019026 18:43756798-43756820 CTCCTACTGGTGTCCTCAAATGG + Intergenic
1161451858 19:4350718-4350740 CTCCATGTGGGGGACTCACAGGG - Intronic
1164706300 19:30322790-30322812 CTCCTAGTGGGGGCCTCAGATGG + Intronic
1165476428 19:36033231-36033253 TTCATAATGGGTGCCTCAGAGGG + Intronic
925490675 2:4389691-4389713 CTTCTGGTGAGGGCCTCAGGAGG + Intergenic
925530357 2:4853038-4853060 CTCCTAGGGCAGGCCTTAGATGG - Intergenic
926487116 2:13475613-13475635 CTCCTGGTGATGGCCTCAGGAGG + Intergenic
928181699 2:29072670-29072692 CTCCTGGTGCGGGCCTGAAATGG + Exonic
928186629 2:29115895-29115917 CTCCTCGTGGCGGCCGCTGACGG + Intronic
930177578 2:48315442-48315464 CGCCTCGAGGGGGCCTCAGAGGG + Intronic
930594347 2:53367681-53367703 CTCCTACTTTGGGGCTCAGAGGG + Intergenic
933727501 2:85435085-85435107 CTCCCAGTGGGGGCTACAGAGGG - Exonic
935429227 2:102956979-102957001 CTTCCACTGTGGGCCTCAGAAGG - Intergenic
936151429 2:110024235-110024257 CTCCTACTGTGGGCCTCAGACGG - Intergenic
936193246 2:110347134-110347156 CTCCTACTGTGGGCCTCAGACGG + Intergenic
937298110 2:120821898-120821920 CACATAGTGGGGGCCTCGGGTGG - Intronic
937489934 2:122356123-122356145 CTGCTGGTGGAGGGCTCAGAGGG + Intergenic
938392340 2:130915966-130915988 CCCCTAGTGGGAGACTCACAGGG - Intronic
938652993 2:133402754-133402776 CTTCTGGTGAGGGCCTCAGGAGG - Intronic
938785947 2:134630009-134630031 CTTCTGGTGAGGCCCTCAGAGGG - Intronic
939103579 2:137924308-137924330 CTCTGAGTTGGGGCCTCAGTAGG - Intergenic
939760250 2:146167453-146167475 CTGCTGGTGAGGGCCTCAGCAGG + Intergenic
942317990 2:174711989-174712011 CTTCTGGTGAGGGCCTCAGGTGG + Intergenic
943939236 2:193970087-193970109 CATCTGGTGAGGGCCTCAGATGG + Intergenic
944679349 2:202062734-202062756 CTTCTGGTGAGGGCCTCAGGAGG - Intergenic
1173399483 20:42711532-42711554 CTTCTGGTGAGGGCCTCAGGAGG - Intronic
1173468185 20:43301174-43301196 CTCCTTGTGTGGACCTCAGCAGG + Intergenic
1173823099 20:46031055-46031077 CTCTGAGAGGGGGACTCAGATGG + Intronic
1174941287 20:54931374-54931396 CTTCTAGTGGTGCCCTCACAAGG - Intergenic
1175608461 20:60330510-60330532 CCCCTACTGGGGTCTTCAGAGGG + Intergenic
1176456309 21:6915346-6915368 CTCTGAGTTGGGGCCTCAGTAGG - Intergenic
1176834483 21:13780406-13780428 CTCTGAGTTGGGGCCTCAGTAGG - Intergenic
1179978500 21:44884467-44884489 CTCCCACTGGGGTACTCAGAGGG - Intergenic
1180061248 21:45386137-45386159 CTCCTTGTGGAGGGCTCTGACGG + Intergenic
1180061286 21:45386283-45386305 CTCCTTGTGGAGGGCTCTGACGG + Intergenic
1181341697 22:22185969-22185991 TGCATAGTGTGGGCCTCAGAAGG + Intergenic
1182370288 22:29805815-29805837 CTCTGGGTGGGGGTCTCAGATGG - Intronic
1183879122 22:40811601-40811623 CTTCTGGTGAGGGCCTCAGGTGG + Intronic
1185297950 22:50063585-50063607 GTCCTGGTGAGGGCCTCCGAGGG - Intronic
949725410 3:7038909-7038931 CTCAGAGTGGGGTCATCAGAGGG + Intronic
949998888 3:9641311-9641333 CTCCTAGTGGGGGTTTCAGTTGG - Intergenic
950111483 3:10421488-10421510 CTCCTACTGGTGGCTGCAGAAGG + Intronic
952684211 3:36130881-36130903 CTCCTAGTGGTCGTCTCAGGAGG + Intergenic
954791603 3:53137259-53137281 CTCATGCTGGGGGCCTCAGCTGG - Intergenic
955073272 3:55589573-55589595 CTCCTCATGGAGGCCTCAGGTGG - Intronic
956470298 3:69559478-69559500 CTCCTAGTTGTGTCCTCACATGG - Intergenic
959434613 3:106298787-106298809 CTTCTGGTGAGGGCCTCAGGAGG - Intergenic
962677066 3:137765112-137765134 CTGCCCGTGGGGGCCTCCGACGG + Exonic
966060889 3:175753816-175753838 CTCATAGTGAAGGCCTCAGGAGG + Intronic
966428259 3:179804232-179804254 GTCCTGTTGGGGGACTCAGAAGG + Intronic
969456761 4:7304692-7304714 CTCCTGGTGGGCGGCTCAGCTGG + Intronic
971784588 4:31084562-31084584 CTTCTAGTGAGGGGCTCAGGGGG + Intronic
971903694 4:32697606-32697628 CTCCTCGTGGTGTCCTCACATGG - Intergenic
985385011 4:189436408-189436430 CTCTTAGTGGGGCCCTCTGGTGG - Intergenic
985627569 5:997821-997843 CTCCCAGTGGGGGTCTGAGGTGG + Intergenic
986333343 5:6734317-6734339 CTCTTTGTGAGGCCCTCAGAGGG - Intronic
994781769 5:104097948-104097970 CTCCTTGTGTGGGGCTGAGAGGG - Intergenic
998786756 5:145719332-145719354 CTCAAGGTGGCGGCCTCAGAAGG + Intronic
1002349699 5:178575484-178575506 CTCCTAGTGAGGGCCTAAGGAGG - Intronic
1003011042 6:2427852-2427874 CTCCTTGTAGTGGCCTCTGAGGG - Intergenic
1005835452 6:29705475-29705497 CTCCTGGAGATGGCCTCAGAAGG - Intergenic
1007728804 6:43933256-43933278 CTCCTTCTGGGGGCCAGAGAAGG - Intergenic
1008020377 6:46570645-46570667 CTTCTGGTGAGGGCCTCAGGAGG + Intronic
1010958876 6:82123035-82123057 CTCCTACTGGGGGATTCAGGTGG - Intergenic
1016021653 6:139242575-139242597 CTGCCAGTAGGGGCCTCAGCTGG - Exonic
1020254849 7:6497387-6497409 CTCCTAGTGGGTCCCTGTGAGGG - Intergenic
1021767416 7:23963796-23963818 GGGCTAGTGGGGGCCTGAGAAGG - Intergenic
1021927541 7:25547699-25547721 CTCCTAGGAGGGTCCTCGGAGGG - Intergenic
1022862084 7:34377641-34377663 CTTCTGGTGAGGACCTCAGAAGG - Intergenic
1025026102 7:55517537-55517559 CTGCTGCTGGGGGCCTCAGGCGG - Intronic
1027590360 7:80111820-80111842 CTTCTGGTGAGAGCCTCAGACGG - Intergenic
1029315887 7:99713422-99713444 CTACTGGTGGGGCACTCAGAGGG - Intronic
1029321604 7:99766332-99766354 CTACTTGTGGGGCACTCAGAGGG - Intronic
1031192060 7:118565499-118565521 CTCCTAGTGATGGCCTCAGGAGG + Intergenic
1032985560 7:137333239-137333261 CATCTAGTGAAGGCCTCAGATGG - Intronic
1033729398 7:144160240-144160262 CTCCTGGTGAGAGCCTCAGGAGG + Intergenic
1034173988 7:149086296-149086318 CTTCTGGCGAGGGCCTCAGATGG + Intronic
1034384634 7:150729937-150729959 CTTCTGGTGAGGGCCTCAGGAGG - Intronic
1035526300 8:315842-315864 CTCAGAGTAGGGGCCTCAGAGGG + Intergenic
1037714002 8:21381614-21381636 CTTCTAGTAGTTGCCTCAGAAGG + Intergenic
1037767057 8:21778527-21778549 CACCTACTGTGTGCCTCAGAAGG - Intronic
1038941377 8:32309548-32309570 CTCTTAGTGGGCTCCTCAGCAGG - Intronic
1043846699 8:85171787-85171809 CTTCTAGTGAGGGTCTCAGGAGG + Intergenic
1046314481 8:112480698-112480720 CTTCTAGTGAGGGTCTCAGAAGG - Intronic
1046876338 8:119258941-119258963 CTTCTGGTGAGGGCCTCAGGAGG + Intergenic
1047111486 8:121794084-121794106 CTCCTCTCTGGGGCCTCAGAGGG - Intergenic
1049758996 8:144323426-144323448 CTCCTCATGGGGGCCTGTGAGGG - Intronic
1055785563 9:79865826-79865848 CTCACATTGGGGGCCTCTGATGG + Intergenic
1057727569 9:97578956-97578978 TTCCTTCTTGGGGCCTCAGATGG + Intronic
1062064960 9:134521805-134521827 CTCAGAGTGGGGGCCTCTGCTGG + Intergenic
1062344013 9:136106577-136106599 GTACTCGTGGGGGCCTCAGCTGG + Intergenic
1062612919 9:137383058-137383080 CTCCCAGAGGTGACCTCAGAGGG + Intronic
1185826154 X:3252876-3252898 CTTCCAGTGGGTGCCTCTGAGGG - Intergenic
1185887254 X:3793720-3793742 GTCTTAGTGGGGGCCACTGAAGG + Intergenic
1186912390 X:14182453-14182475 TTCCCAGTGAGGGCCCCAGAAGG - Intergenic
1189339291 X:40192406-40192428 CTGCTAGCTGGGGCCTCAGCTGG - Intergenic
1194183011 X:90737074-90737096 TTCTTGGTGGGAGCCTCAGATGG - Intergenic
1196001222 X:110788411-110788433 CTCCTATTTGGGGCATCACAGGG - Intronic
1196055237 X:111348475-111348497 CTCCCACTGGGGGCCTCTCAAGG + Intronic
1196903853 X:120412481-120412503 ATCCTAGAGGGCGCCTCAGGTGG - Intergenic
1198021186 X:132659576-132659598 CTGCTGCTGGAGGCCTCAGATGG - Intronic
1198937818 X:141917075-141917097 CTCCTGGTAGGACCCTCAGAAGG - Intergenic
1201071512 Y:10151028-10151050 CTCCTAGATGGGTCCTCACATGG - Intergenic
1201574361 Y:15446303-15446325 CACCTAGTGGGAGCCACAGGTGG - Intergenic