ID: 1164706302

View in Genome Browser
Species Human (GRCh38)
Location 19:30322797-30322819
Sequence TGGGGGCCTCAGATGGCCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 291}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164706291_1164706302 5 Left 1164706291 19:30322769-30322791 CCACCGAGCCCCTTACTCTCACT 0: 1
1: 0
2: 4
3: 10
4: 191
Right 1164706302 19:30322797-30322819 TGGGGGCCTCAGATGGCCTGCGG 0: 1
1: 0
2: 4
3: 29
4: 291
1164706287_1164706302 14 Left 1164706287 19:30322760-30322782 CCCTCCTGCCCACCGAGCCCCTT 0: 1
1: 0
2: 3
3: 37
4: 362
Right 1164706302 19:30322797-30322819 TGGGGGCCTCAGATGGCCTGCGG 0: 1
1: 0
2: 4
3: 29
4: 291
1164706293_1164706302 -3 Left 1164706293 19:30322777-30322799 CCCCTTACTCTCACTCCTAGTGG 0: 1
1: 0
2: 2
3: 28
4: 298
Right 1164706302 19:30322797-30322819 TGGGGGCCTCAGATGGCCTGCGG 0: 1
1: 0
2: 4
3: 29
4: 291
1164706288_1164706302 13 Left 1164706288 19:30322761-30322783 CCTCCTGCCCACCGAGCCCCTTA No data
Right 1164706302 19:30322797-30322819 TGGGGGCCTCAGATGGCCTGCGG 0: 1
1: 0
2: 4
3: 29
4: 291
1164706289_1164706302 10 Left 1164706289 19:30322764-30322786 CCTGCCCACCGAGCCCCTTACTC 0: 1
1: 0
2: 1
3: 11
4: 213
Right 1164706302 19:30322797-30322819 TGGGGGCCTCAGATGGCCTGCGG 0: 1
1: 0
2: 4
3: 29
4: 291
1164706290_1164706302 6 Left 1164706290 19:30322768-30322790 CCCACCGAGCCCCTTACTCTCAC 0: 1
1: 0
2: 1
3: 5
4: 108
Right 1164706302 19:30322797-30322819 TGGGGGCCTCAGATGGCCTGCGG 0: 1
1: 0
2: 4
3: 29
4: 291
1164706285_1164706302 27 Left 1164706285 19:30322747-30322769 CCTCCATTCACAGCCCTCCTGCC 0: 1
1: 0
2: 8
3: 44
4: 538
Right 1164706302 19:30322797-30322819 TGGGGGCCTCAGATGGCCTGCGG 0: 1
1: 0
2: 4
3: 29
4: 291
1164706284_1164706302 28 Left 1164706284 19:30322746-30322768 CCCTCCATTCACAGCCCTCCTGC 0: 1
1: 0
2: 3
3: 30
4: 428
Right 1164706302 19:30322797-30322819 TGGGGGCCTCAGATGGCCTGCGG 0: 1
1: 0
2: 4
3: 29
4: 291
1164706292_1164706302 2 Left 1164706292 19:30322772-30322794 CCGAGCCCCTTACTCTCACTCCT 0: 1
1: 0
2: 2
3: 40
4: 470
Right 1164706302 19:30322797-30322819 TGGGGGCCTCAGATGGCCTGCGG 0: 1
1: 0
2: 4
3: 29
4: 291
1164706286_1164706302 24 Left 1164706286 19:30322750-30322772 CCATTCACAGCCCTCCTGCCCAC 0: 1
1: 0
2: 5
3: 56
4: 536
Right 1164706302 19:30322797-30322819 TGGGGGCCTCAGATGGCCTGCGG 0: 1
1: 0
2: 4
3: 29
4: 291
1164706295_1164706302 -4 Left 1164706295 19:30322778-30322800 CCCTTACTCTCACTCCTAGTGGG 0: 1
1: 0
2: 1
3: 11
4: 146
Right 1164706302 19:30322797-30322819 TGGGGGCCTCAGATGGCCTGCGG 0: 1
1: 0
2: 4
3: 29
4: 291
1164706297_1164706302 -5 Left 1164706297 19:30322779-30322801 CCTTACTCTCACTCCTAGTGGGG 0: 1
1: 0
2: 0
3: 7
4: 127
Right 1164706302 19:30322797-30322819 TGGGGGCCTCAGATGGCCTGCGG 0: 1
1: 0
2: 4
3: 29
4: 291

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164706302 Original CRISPR TGGGGGCCTCAGATGGCCTG CGG Intronic
901857064 1:12051371-12051393 TGGTGGCCTCATTTGTCCTGTGG + Intergenic
902269307 1:15291745-15291767 TGCGGTCCTCTGAAGGCCTGGGG + Intronic
904042413 1:27592469-27592491 TGGGGGCCCCAGAGACCCTGTGG + Intronic
904477987 1:30776855-30776877 TGGGGGCCTCGGATGGGAAGGGG + Intergenic
904490716 1:30857265-30857287 AGGGAGCCCCAGGTGGCCTGAGG - Intergenic
905887217 1:41497810-41497832 TGGGGGTCCCAGCTGGCCTGGGG + Intergenic
905920709 1:41716780-41716802 TGGGGAGCTCAGAGGGGCTGGGG + Intronic
908355550 1:63322910-63322932 AGGGGGCCGCAGGTGGCTTGGGG - Intergenic
912391856 1:109308447-109308469 TTGGGGCCTTGGATGGCCTATGG + Intergenic
915224362 1:154401779-154401801 TGAGGGCCTCAGCCTGCCTGTGG - Intergenic
915509625 1:156379495-156379517 AGGAGGCCTCAGCTGGCCTGGGG - Intronic
917797934 1:178545287-178545309 TGGGGTCCCCAGAGAGCCTGGGG - Intronic
919425261 1:197421922-197421944 TGGGGCCTTCATAGGGCCTGTGG - Exonic
919765967 1:201127501-201127523 AGGGAGCCTCAGATAGCCTCTGG + Intergenic
922176443 1:223201530-223201552 TTGGGTCCTCCCATGGCCTGAGG - Intergenic
922575110 1:226655998-226656020 TGCGGGCCTAAGGTGGCGTGGGG - Intronic
924589515 1:245389945-245389967 TTAGGGACTCAGATGGTCTGTGG - Intronic
1063174526 10:3539591-3539613 TGGTGGCCTCAGAGTGTCTGGGG + Intergenic
1064229576 10:13518249-13518271 TGGGGGCAGCAGCTGTCCTGGGG - Intronic
1064296142 10:14080515-14080537 TGGAGCACTCACATGGCCTGAGG - Intronic
1067059976 10:43073265-43073287 TGTGGGCCTCAGGTGCCCTCAGG - Intergenic
1067568736 10:47356395-47356417 TGGTGGCCGCAGGTGGCTTGTGG - Intronic
1068313147 10:55305463-55305485 TGGGGGCCTCAGCTGGCTACAGG - Intronic
1070764493 10:79048592-79048614 TGTGGGTCTGAGGTGGCCTGGGG + Intergenic
1070769618 10:79074664-79074686 TGGGTGCCCCACATAGCCTGGGG - Intronic
1070776537 10:79113125-79113147 TCGGAGCCTCAGGTGGCCTCTGG + Intronic
1070830812 10:79417178-79417200 GGGAGGGCTCAGAGGGCCTGCGG + Intronic
1073086785 10:100896173-100896195 TGGGGGACTTTGATGGGCTGAGG - Intergenic
1073116607 10:101095026-101095048 TGGGGTCCTGGGATGGCATGGGG - Intronic
1074109778 10:110414679-110414701 TGGGTGACTCAGCAGGCCTGAGG - Intergenic
1074771484 10:116737730-116737752 TGGCAGCCGCAGATGTCCTGCGG - Intronic
1075045241 10:119141143-119141165 TGGGGTCCCCAGAAGACCTGTGG + Exonic
1075265868 10:120999247-120999269 CTGGGGGCTCAGCTGGCCTGTGG + Intergenic
1075287599 10:121200859-121200881 TGGGGTCTTCAGCTGCCCTGGGG - Intergenic
1075822826 10:125329247-125329269 TGAGGGCCTCAGTTGGCCACAGG - Intergenic
1076855749 10:133114974-133114996 TGGGGGCCTTCGATGCACTGAGG - Intronic
1077306314 11:1870198-1870220 TGGGAGACTCACATGGCCTTGGG - Intronic
1077336516 11:2007299-2007321 TGGGGGCTCCAGGTGTCCTGTGG + Intergenic
1077675457 11:4190492-4190514 TGGGGGCCTCAGGGAGCCTGGGG - Intergenic
1078545678 11:12245501-12245523 TGGTGGCCTCAGATGGGATGGGG - Intronic
1078670002 11:13356111-13356133 TGAGGGCCACAGAAGTCCTGGGG - Intronic
1084303581 11:68266933-68266955 AGGGGGCAGCAGAAGGCCTGGGG - Intronic
1084457676 11:69277841-69277863 TGGGGGTCTCACCTGGGCTGGGG + Intergenic
1084560036 11:69899495-69899517 ACGTGGCCACAGATGGCCTGGGG - Intergenic
1084783691 11:71429263-71429285 TGAGGGCCTCAGCCGCCCTGTGG - Intronic
1084800763 11:71542344-71542366 TGGGGCCCCTAGATGGCCTCAGG - Intronic
1085444175 11:76589661-76589683 TGGTGGCATCAGGTGGGCTGGGG + Intergenic
1085535283 11:77213758-77213780 TGGGCTCCTCTGAGGGCCTGAGG + Intronic
1086338910 11:85827247-85827269 TAGGGGCCTCAGAGGGCCTTGGG - Intergenic
1086363756 11:86087433-86087455 TGGGGCCCTTAGACGGCCTCAGG + Intergenic
1088148483 11:106714679-106714701 TGAGGGGCTCAGATGACCTCAGG - Intronic
1089157436 11:116413384-116413406 TGGGAGCCTGGGATGGCCTGTGG - Intergenic
1089306325 11:117528540-117528562 TGGGGATCTGAGATGCCCTGGGG + Intronic
1089457097 11:118632084-118632106 TGGGGCCTTCAGTTGGCCTAGGG - Intronic
1090029273 11:123194124-123194146 TTGGGGCCTCAGAGGCCCTGAGG - Intronic
1202819500 11_KI270721v1_random:62481-62503 TGGGGGCTCCAGGTGTCCTGTGG + Intergenic
1091434826 12:464114-464136 TGGGACACTCAGAGGGCCTGGGG + Intronic
1092238721 12:6824908-6824930 TGGGGGCCACAAATGGAGTGGGG - Intronic
1092290184 12:7155770-7155792 TGGTGGCCTCAAGTGGGCTGTGG + Intronic
1092961351 12:13599247-13599269 TGGGGGCCTGAGACTCCCTGAGG - Intronic
1094872310 12:34605242-34605264 GGGGGGCCCGAGATGCCCTGTGG - Intergenic
1096466023 12:51848208-51848230 CGGGGGCGTCTGCTGGCCTGGGG - Intergenic
1099449696 12:82794152-82794174 TGCTGGCCTCAGCTGGCATGTGG + Intronic
1101935488 12:109053123-109053145 TGGGGGACCCAGAAGGACTGGGG - Intronic
1103702482 12:122855148-122855170 TGGGGTCCTCAAAGGGCCTCGGG - Intronic
1103751595 12:123167783-123167805 TGGGAACCTCAGATGAGCTGGGG - Intronic
1103947647 12:124535428-124535450 TGGGGGCCTCGGGGGGCGTGTGG - Intronic
1111812373 13:93107274-93107296 TGGGGGCCTCAGATAACATTAGG + Intergenic
1113064427 13:106359020-106359042 TGGGGAGCACAGCTGGCCTGAGG - Intergenic
1113185760 13:107684106-107684128 TGGGAGCCACAGATGGCTGGTGG - Intronic
1116243530 14:42378985-42379007 GGGTAGCCTCAGATGCCCTGGGG + Intergenic
1116861376 14:49998235-49998257 TGGTGGCAGCAGATGGCCTGGGG + Intronic
1118710882 14:68518539-68518561 GGGGGGGCTCATATGACCTGGGG - Intronic
1118815703 14:69312417-69312439 TTGGGGCCTCAGTTGCCTTGAGG + Intronic
1119430997 14:74567866-74567888 CAGGGGCCTCAGACTGCCTGCGG - Intronic
1121006841 14:90496122-90496144 TGGAGGCCTCAGCTGGACTCTGG - Intergenic
1121579282 14:95014681-95014703 AGGGGGCCTCAGGTGGGCTCTGG + Intergenic
1122251287 14:100441584-100441606 TGGGGCCTGCAGATGGGCTGGGG + Intronic
1122635681 14:103128601-103128623 CGGGGGCCTTGGGTGGCCTGTGG + Intronic
1122792551 14:104190463-104190485 AGGTGGCCTCTGGTGGCCTGTGG + Intergenic
1122924438 14:104893141-104893163 CAGGGGCCTCAGAAAGCCTGGGG - Intronic
1124219099 15:27834055-27834077 TGGGGGCCCTAGATGGCTTCAGG + Intronic
1124242283 15:28038573-28038595 TTGGTGCCTTAGATGGACTGTGG - Intronic
1124638387 15:31379566-31379588 CGGGGGCCTCTGAAGGCCTTAGG - Intronic
1125391663 15:39199219-39199241 TGGGGGACTCAGAAAGCCTGGGG + Intergenic
1125895973 15:43301981-43302003 TGGGGGGCTGAAATGGCCTTGGG - Intronic
1126619363 15:50621472-50621494 TGGGGGCCTCAGGTGTCCCCAGG - Intronic
1126808119 15:52373652-52373674 TGGGAGCCTGAGCTGGCCGGAGG + Intronic
1127208361 15:56744260-56744282 TAGGGGACTCAGATGCCGTGTGG - Intronic
1128089973 15:64912593-64912615 TGTGGGCATCAGCTGGCCTGGGG + Intronic
1128694119 15:69747549-69747571 TGTGGGCCTTATATGGGCTGTGG + Intergenic
1129854261 15:78812320-78812342 TGCGGGCCTCAGAGGGCAGGGGG - Intronic
1130011034 15:80153010-80153032 TGCGGGCCTAAGGTGGCGTGCGG - Exonic
1130904778 15:88232743-88232765 TGGGGTCCTCAGTAGGCCTCTGG - Intronic
1131359840 15:91780876-91780898 TGGGGGCCTCAGTTCCCCAGTGG + Intergenic
1131538035 15:93253775-93253797 TGCAGGCCTGAGATGGGCTGGGG - Intergenic
1132821925 16:1877575-1877597 TGAGGGCATGAGATGGGCTGGGG - Intronic
1133322218 16:4921394-4921416 TGGGGGCCTCAGATGGCATCAGG + Intronic
1133805355 16:9122497-9122519 TGGGAGCTTCAGAAGGCCTGTGG + Intergenic
1134134840 16:11671321-11671343 TGGGGGATCCAGATGGCCTTGGG + Intronic
1137686557 16:50390734-50390756 GGGGGCCCTGGGATGGCCTGCGG - Intergenic
1138374416 16:56553009-56553031 TGGGAGGCTGAGATGACCTGAGG - Intergenic
1138676013 16:58651860-58651882 TGGGAGACTCAGATGACTTGAGG + Intergenic
1139426788 16:66885507-66885529 TGCTGGCCTCAGATGGCCTGTGG + Exonic
1140040748 16:71406052-71406074 TGGAGGCCTCAGATGGCCCTAGG - Intergenic
1140042782 16:71420010-71420032 TGGAGGCCTCAGATGGCCCTAGG - Intergenic
1140772005 16:78213864-78213886 TGGGGGCCCCAGAAGCCCTCAGG - Intronic
1141660565 16:85439075-85439097 TGGGGGCCTCAGAGGGCCAGAGG - Intergenic
1142696217 17:1635259-1635281 TGGGGGCCGCCGGTGGCCAGTGG + Exonic
1143021998 17:3921684-3921706 TGTGAGGCTCAGATGGGCTGGGG - Intergenic
1143584777 17:7845611-7845633 TGGGGGCCTGAGCTGTGCTGGGG + Exonic
1143605858 17:7985242-7985264 TGGCCACCTCAGGTGGCCTGAGG + Intergenic
1144294868 17:13864539-13864561 TGGGAGGATCAGATGGCATGTGG - Intergenic
1145273074 17:21414893-21414915 TGGCAGCCACAGAGGGCCTGTGG - Intronic
1145303582 17:21656993-21657015 CCGGGGCCTCAGCTGGCCCGGGG + Intergenic
1145311268 17:21702337-21702359 TGGCAGCCACAGAGGGCCTGTGG - Intronic
1146277764 17:31525909-31525931 CTGGGGCCTCAGGGGGCCTGAGG - Intronic
1146517650 17:33501919-33501941 TGGAGGCCTTAGAGGGCCAGTGG + Intronic
1146846306 17:36183670-36183692 CGGGGGCCACAGCTGGGCTGGGG - Intronic
1146911893 17:36653719-36653741 TGGAGGCCTTAGGAGGCCTGGGG - Intergenic
1147265204 17:39230711-39230733 TGGGGATCTCAGATGCCCTGAGG - Intergenic
1148163999 17:45469552-45469574 TTGGGGCCTTAGACAGCCTGTGG - Intronic
1148560913 17:48605555-48605577 TGGGGGCCTTAGATTCCCTAGGG + Intergenic
1149895049 17:60422594-60422616 TGGAGGCCTCAGATGGGCAAGGG + Exonic
1150097968 17:62395400-62395422 TGGGGCCCTTAGGTGGTCTGAGG - Intronic
1150225506 17:63522809-63522831 TAGGGGCCTCAGGTGGTCTTTGG - Intergenic
1150395231 17:64816206-64816228 TTGGGGCCTTAGACAGCCTGTGG - Intergenic
1151815114 17:76467990-76468012 CGGGGGCTGCAGAGGGCCTGGGG - Intronic
1155967438 18:32049241-32049263 TGGTGGAATCAGATTGCCTGTGG + Intronic
1158071717 18:53478149-53478171 TGGAGACCTCAGCTGACCTGAGG + Intronic
1158414818 18:57240841-57240863 TGGGGAGCTCAAATGGACTGAGG + Intergenic
1160147775 18:76378809-76378831 TGGGGGTCACATGTGGCCTGGGG + Intronic
1160385246 18:78492932-78492954 TGGGGGCGTCAGATGGACAAGGG - Intergenic
1160529183 18:79553638-79553660 TGGGGGCAGGAGATGGCGTGGGG - Intergenic
1160534441 18:79584715-79584737 TGGTGGGTTCAGGTGGCCTGAGG + Intergenic
1160750429 19:731486-731508 TGGGGGCATCAGAAGGACTCAGG + Intronic
1160750441 19:731526-731548 TGGGGGCATCAGAAGGGCTCAGG + Intronic
1160750453 19:731566-731588 TGGGGGCATCAGAAGGGCTCAGG + Intronic
1160750465 19:731606-731628 TGGGGGCGTCAGAAGGGCTCAGG + Intronic
1160758964 19:773027-773049 TGGTGGCCTCATTTGGCTTGGGG - Intergenic
1161196191 19:2987899-2987921 AGGAGGCCTCAGGTGGCCTGGGG - Exonic
1162124965 19:8494475-8494497 TGACAGCCTCAGAGGGCCTGGGG - Intronic
1163517715 19:17774999-17775021 AGGGGGCACCAGATGGGCTGCGG + Intronic
1163666316 19:18605735-18605757 GGGGGGCCCCAGAGTGCCTGAGG + Intronic
1164678382 19:30118129-30118151 TGGTGGCCTCTGCTGGCCTGAGG + Intergenic
1164706302 19:30322797-30322819 TGGGGGCCTCAGATGGCCTGCGG + Intronic
1165091111 19:33388857-33388879 AGGGGGCCTCAGCTTGGCTGAGG + Intronic
1165137315 19:33677795-33677817 AGGGTGCCTCACTTGGCCTGGGG + Intronic
1166297988 19:41897960-41897982 TGGGGCGCTCAGAGAGCCTGCGG + Intronic
1166539975 19:43598825-43598847 CGGGGCCCCCAGGTGGCCTGAGG - Exonic
1166872088 19:45877035-45877057 TGGGGACCTCAGGTGGCCGGAGG + Intergenic
1166972968 19:46582732-46582754 TGCTGGCCACAGAGGGCCTGAGG - Intronic
1167053992 19:47097394-47097416 TGAGGGCCTGACATGGCCAGAGG - Intronic
1168026577 19:53647905-53647927 GGGGGGCTTCAGAGGGCGTGGGG - Intergenic
1168701281 19:58440956-58440978 TGGGGCCCGCAGAGGACCTGGGG - Intergenic
926206883 2:10840260-10840282 TGGTGGCAGCAGATGCCCTGGGG + Intergenic
927886390 2:26721240-26721262 TGGGGGCCTGAGAGGGGCAGAGG + Intronic
927925905 2:27013518-27013540 TGGGGGGTTCAGATGGCAGGTGG - Intronic
929174088 2:38959834-38959856 TGGGGGCATCAGATGTCTTTAGG - Exonic
930001126 2:46862157-46862179 TGGGAGTCGCAGATGCCCTGGGG - Intergenic
931613126 2:64125283-64125305 TGGGGCCCTGAGATGGCATCAGG - Intronic
934732046 2:96665524-96665546 TGGGATCCTCAGATGTTCTGTGG + Intergenic
934926903 2:98388520-98388542 TGGGGGCTTCACATGGTCTCAGG - Intronic
935035139 2:99363405-99363427 TGTTGGTCTCAGATGTCCTGAGG - Intronic
936086746 2:109474508-109474530 GGAGGCCCTCAGTTGGCCTGAGG + Intronic
937138655 2:119578053-119578075 CTGGGAGCTCAGATGGCCTGAGG + Intronic
938785946 2:134630002-134630024 TGAGGCCCTCAGAGGGCCTGTGG - Intronic
940054003 2:149494212-149494234 TGGGGGTCTAAAAAGGCCTGAGG - Intergenic
940190640 2:151036977-151036999 TGGGGTCCCCAGATAGCCTCAGG + Intronic
944676185 2:202035231-202035253 CGGGGGCCTCAGATGGCAGGGGG + Exonic
948836049 2:240626471-240626493 TTGGGGTCTCAGGTGGGCTGAGG + Intronic
948886601 2:240888072-240888094 TGGTGGCCTCACAGGGCCTGGGG - Intronic
948892241 2:240913145-240913167 TGAGGGCCTCAAATGTTCTGTGG - Intergenic
948921031 2:241065971-241065993 TGGGGTGCTCTGAAGGCCTGGGG + Intronic
948992917 2:241563824-241563846 AGGGGTCTTCAGATGGCCTCGGG + Intronic
1170557065 20:17523369-17523391 AGAGGGCCTCGGAGGGCCTGAGG + Intronic
1171521103 20:25774678-25774700 CCGGGGCCTCAGCTGGCCCGGGG + Exonic
1171555823 20:26081801-26081823 CCGGGGCCTCAGCTGGCCCGGGG - Intergenic
1172783649 20:37451821-37451843 GGGTGGCCACAGATGTCCTGGGG - Intergenic
1175387655 20:58607697-58607719 TGAGGGCCTCCGAGGGCCTGAGG + Intergenic
1175688651 20:61049827-61049849 TGGTGGCATCAGGAGGCCTGTGG + Intergenic
1175784914 20:61706297-61706319 AGGGGGCTTCAGAGGGCCGGGGG + Intronic
1176661103 21:9635478-9635500 TGGGAGCCTCACCCGGCCTGGGG - Intergenic
1178061649 21:28859668-28859690 TGGGGACCTCAGGTGTACTGTGG + Intergenic
1178491523 21:33055560-33055582 TGGGGGGCTCACAAGGCCTTGGG + Intergenic
1179721162 21:43316649-43316671 TGGGGTCCAGAGATGTCCTGTGG - Intergenic
1180707074 22:17816653-17816675 AGGGGGCTTCACAGGGCCTGGGG - Intronic
1182391470 22:30000774-30000796 GGGCGGCCTCAGAGAGCCTGTGG + Intronic
1182431718 22:30302698-30302720 TGGAGGCCTCAGCTGGGCAGGGG + Intronic
1182463018 22:30495541-30495563 GAGGGGCCTCAGATGGCCTGGGG + Intronic
1183032356 22:35115737-35115759 TGAGGGCCAATGATGGCCTGCGG - Intergenic
1183445244 22:37849309-37849331 TGGCTGTCTCAGATGGCCAGAGG + Exonic
1183542159 22:38435772-38435794 TGAGGGCCTCAGCTGGAGTGGGG - Intronic
1183713227 22:39519166-39519188 TGAGCGCAGCAGATGGCCTGTGG + Intergenic
1184243311 22:43222805-43222827 TTGGGGCCTCAGAGGGATTGTGG + Intronic
1184245757 22:43235046-43235068 TGGGGGCATGAGAGGGCCTTGGG + Intronic
1184473559 22:44709080-44709102 TGGGGGTCTCTGAAGGCCAGAGG + Intronic
1184489955 22:44802737-44802759 AGGGGGCCCCAGATGACTTGTGG + Intronic
1184854036 22:47136776-47136798 TGAGGGCCACAGGTGTCCTGGGG - Intronic
1185041342 22:48506055-48506077 GGGCGACCTCAGCTGGCCTGGGG - Intronic
1185075875 22:48682001-48682023 TCGGGGCCTCCCAGGGCCTGAGG + Intronic
1185265970 22:49904129-49904151 AGGGGCCCTCACATGGCCTCTGG + Intronic
1185266522 22:49906970-49906992 TGGGGGCCTGGCAGGGCCTGGGG - Intronic
950610305 3:14122695-14122717 TGAGAGCATCAGATGGGCTGTGG - Intronic
951951320 3:28202448-28202470 TGGGAGCCTCTGATGGTCAGAGG - Intergenic
953532649 3:43752413-43752435 TGGGGGCAACAGAGGGCTTGGGG + Intergenic
954215640 3:49122944-49122966 TGGGGGCCTCAGCTGCAATGGGG - Exonic
955134438 3:56202077-56202099 TGCTGTGCTCAGATGGCCTGCGG - Intronic
955448742 3:59043512-59043534 TGGGGGCTTGAGGAGGCCTGGGG + Intronic
960043694 3:113175767-113175789 TTGGGGCCTCAGTTTCCCTGTGG + Intergenic
961423971 3:126830474-126830496 TGGAGACCTCAGGTGCCCTGTGG + Intronic
961501586 3:127340191-127340213 TGGGGGCCTCTGGTGGGCAGTGG - Intergenic
961743837 3:129050781-129050803 TGAGGGCCTCAGAGGACCAGGGG + Intergenic
965838067 3:172872721-172872743 AGGGGGCCTCAGAAGCCCAGAGG - Intergenic
967727034 3:192871694-192871716 TGGAGGCCAAAGATGGGCTGTGG + Intronic
968603115 4:1519659-1519681 TGGGGGGCTCTGCCGGCCTGTGG - Intergenic
969114501 4:4862695-4862717 TGGGGGGCTCAGCCGCCCTGAGG - Exonic
969151100 4:5169136-5169158 AGGGGCACTCAGCTGGCCTGTGG - Intronic
969570857 4:8007410-8007432 TGCGGGTCTCAGCTGGGCTGGGG - Intronic
970318763 4:14855237-14855259 TGGTGGCCTCAGAAACCCTGTGG - Intergenic
972370161 4:38415884-38415906 TGATGGCCTCAGATGGCCTCTGG + Intergenic
972840951 4:42929488-42929510 TGGCAGCCTCAGAGTGCCTGTGG + Intronic
979546400 4:121944928-121944950 TGGGGATTTCAGATGGCCTGGGG + Intronic
985414294 4:189721058-189721080 TGGGAGCCTCACCCGGCCTGGGG + Intergenic
985541948 5:491510-491532 TGGGGGCTGCAGGTGGCCAGGGG - Intronic
985542593 5:493795-493817 CGGGGGGCTCAGAGAGCCTGTGG - Intronic
985672683 5:1214388-1214410 TGGGGGCCTGGGATGCCCAGGGG - Intronic
985761403 5:1751133-1751155 TGGGCGCCTCCCATGGCCTCGGG + Intergenic
985775741 5:1840904-1840926 TGGGGATCTCAGATGCCTTGGGG - Intergenic
987060263 5:14236185-14236207 TGGGGACCTCTGATGTTCTGGGG - Intronic
988544962 5:32146976-32146998 TGTGGGCCGCAGGTGGCCTACGG - Intronic
989210733 5:38856392-38856414 TGTGGTCCTCAGGTGGCCTGGGG + Intronic
991400051 5:66242429-66242451 TGGGGACCCCTGATGGTCTGGGG + Intergenic
995555130 5:113319904-113319926 TTGGGGCCTCATATGGCCATTGG - Intronic
995703535 5:114961685-114961707 AGGGGGGCTCACATGGCCTTGGG + Intergenic
997391655 5:133522055-133522077 TGGGGAACTCTGAGGGCCTGGGG - Intronic
997513413 5:134468059-134468081 AGGGAGCCTGAGATTGCCTGGGG - Intergenic
997528745 5:134569631-134569653 TGGGAGCCTGACCTGGCCTGAGG + Intronic
998039964 5:138945629-138945651 TGGGGGCAGCAGTGGGCCTGCGG - Intergenic
998095076 5:139392188-139392210 TGGGGGCTGCCGAGGGCCTGCGG + Exonic
999865491 5:155696155-155696177 TGTGGTTCTCAGCTGGCCTGTGG + Intergenic
1000315773 5:160089287-160089309 TGGGAGGCTAAGATGGCTTGAGG - Intronic
1002309089 5:178303778-178303800 TGGGGGCCTAACCTGCCCTGAGG + Intronic
1002640444 5:180628228-180628250 TGGATGACTCAGACGGCCTGAGG + Intronic
1002963636 6:1941286-1941308 TGGTGGTCTCAGCTGGCCTCAGG - Intronic
1003090984 6:3102835-3102857 TTGGGACCTCAGATCACCTGAGG - Intronic
1003151065 6:3549250-3549272 AGGTGGGCTCAGATGGCCTCAGG + Intergenic
1003394216 6:5739537-5739559 TGGGGCCCTCAGGTGCCCAGTGG + Intronic
1003977984 6:11361840-11361862 TTGGGGGCTGAGATGGGCTGGGG + Intronic
1004368141 6:15029266-15029288 TGGGGGCCTCAAATGATATGAGG - Intergenic
1005015994 6:21376002-21376024 CATGGGCCTCAGAAGGCCTGAGG + Intergenic
1005320971 6:24653401-24653423 AGGGAGCCGCTGATGGCCTGGGG - Intronic
1006303125 6:33204549-33204571 TGGTGGCCGCAGATGGCCTAAGG + Intergenic
1006438630 6:34040004-34040026 TGGGGGCCTCAGAGCCGCTGAGG + Intronic
1006620551 6:35360959-35360981 TGGGGCCTACAGCTGGCCTGAGG - Intronic
1006640075 6:35485346-35485368 TTGGGCCCTCAGAGGGTCTGTGG - Intronic
1006836628 6:37002861-37002883 GTGGGGCCTCAGAAGGCATGTGG - Intergenic
1007109362 6:39304150-39304172 TGAAGGCCTCAGGAGGCCTGGGG - Intronic
1007922154 6:45620140-45620162 TGTGGGCACCAGATGGGCTGTGG - Intronic
1018134621 6:160767350-160767372 TGGGAGCCGCAGCTGGCCCGTGG - Intergenic
1018745036 6:166755173-166755195 AGGTGGCCTCAGATGGCCCCTGG + Intronic
1018824501 6:167398943-167398965 TGGCTGCCTCAGAGGGGCTGTGG + Intergenic
1019316944 7:391243-391265 TGGGGTCCTGAGGTGCCCTGAGG + Intergenic
1019358879 7:594766-594788 TGGGGTCCTCTCATGGTCTGGGG - Intronic
1019458106 7:1142282-1142304 TGGGTGCCACAGAAGTCCTGGGG + Intergenic
1019460444 7:1155764-1155786 TGTGGGCATCAGCTGCCCTGAGG + Intronic
1019565096 7:1675150-1675172 AGTGGGCCACAGAGGGCCTGGGG - Intergenic
1019598438 7:1869204-1869226 TGGGGGCCACAGAGGCCCGGGGG + Intronic
1019840676 7:3439858-3439880 TGCTGTCCTCAGATGCCCTGAGG + Intronic
1019963879 7:4483562-4483584 TGGAGGGCTCAGGTGGGCTGTGG - Intergenic
1019997163 7:4732003-4732025 TGGGCTGCTCAGATGCCCTGGGG - Intronic
1020125646 7:5531238-5531260 TGGGGGAGTCAGGTGGCTTGCGG + Intronic
1020209594 7:6148674-6148696 TGGGGGCCTCATCTGAGCTGTGG + Intronic
1023017211 7:35980512-35980534 TGTGGGCTTCAGTGGGCCTGGGG + Intergenic
1023583352 7:41704928-41704950 CGGTGGCATCAGATGGCCAGCGG - Intergenic
1023841561 7:44101298-44101320 TGGGGGCCACAGAGGCCATGGGG + Intergenic
1024701173 7:51905978-51906000 TGGGGGCCTAAGATGGGATTGGG + Intergenic
1026284443 7:68950823-68950845 TGGTGCCCTCAGATCACCTGAGG + Intergenic
1030657624 7:112185156-112185178 TGGGGGCCACAGCTGGTCTTGGG + Intronic
1030902105 7:115137336-115137358 TGTGGGACTCACATGCCCTGTGG - Intergenic
1032018942 7:128396030-128396052 TTGGGTCCTCACTTGGCCTGAGG - Intronic
1032389666 7:131547771-131547793 TGGGGGCCACTGAGGGCTTGGGG - Intronic
1035422902 7:158743838-158743860 TGGGAGGCTCAGATCACCTGAGG + Intronic
1037363855 8:18102308-18102330 TGGGGCCCTCATATGACATGTGG + Intergenic
1037679721 8:21086829-21086851 TGCAGGCCACAGAGGGCCTGGGG + Intergenic
1039836685 8:41261763-41261785 TGGGGGCCACGGGTAGCCTGTGG + Intergenic
1040372775 8:46794041-46794063 CAGGGGCCTCAGAGGGCCCGGGG + Intergenic
1042968126 8:74378270-74378292 TGGGGTCACCAGATGCCCTGAGG - Intronic
1044965620 8:97571180-97571202 TGGGGGCTTCAGAACACCTGGGG - Intergenic
1047403156 8:124562787-124562809 TGGGGGCCTCTGGCGGCATGGGG + Exonic
1048365621 8:133735825-133735847 TGGGGGCCTCTGATTCCCTAGGG + Intergenic
1048976167 8:139674205-139674227 TGGGGCCCTGTGATGGGCTGAGG + Intronic
1048996090 8:139794497-139794519 TGGGAGCCTCAGTTGAGCTGAGG + Intronic
1049434948 8:142582227-142582249 TGGAGCCCACAGTTGGCCTGAGG + Intergenic
1049647306 8:143741248-143741270 TGGGGGCCTCAGCCGCTCTGCGG + Intergenic
1050001107 9:1077713-1077735 TGGTGGCATCTGATGGCCTAAGG - Intergenic
1052914956 9:33917893-33917915 TGGAGGCCTCAGCTGCTCTGAGG + Exonic
1056552504 9:87663646-87663668 TGGGGGCCAGAGAGGGCCAGGGG - Intronic
1056706360 9:88955468-88955490 TGGGGCCCAGAGATGCCCTGAGG + Intergenic
1057315945 9:93968601-93968623 TGGGGGCCTGGGCTGGTCTGGGG - Intergenic
1057806925 9:98226051-98226073 TGAGGGTCTCAGATGGACAGCGG + Intronic
1057847513 9:98536916-98536938 TGTGGCCCTCAGCAGGCCTGGGG - Intronic
1059528544 9:115015303-115015325 TGGGGGGCACAGGTGGCCAGGGG + Intergenic
1060576870 9:124703890-124703912 TGGGAGGCTCAGGTGGCATGAGG - Intronic
1060593255 9:124832785-124832807 TGGGCTCCCCACATGGCCTGGGG - Intergenic
1061090680 9:128424285-128424307 TGGGGGCCTTGGGTGGACTGAGG + Intronic
1061480772 9:130896775-130896797 GGGCTGCCTCCGATGGCCTGAGG + Intergenic
1061750068 9:132770981-132771003 AGGGGGCCTCAGGAGGCCTCTGG + Intronic
1061820556 9:133225318-133225340 TGGAGGCCTGAGCTAGCCTGGGG + Intergenic
1061946032 9:133908541-133908563 TGGGGGCCTAGGATGGGCTGGGG - Intronic
1062206990 9:135342801-135342823 TCGGGGCCTCTGGTGGCCTGGGG + Intergenic
1062238709 9:135524740-135524762 TGGAGGCCTGAGCTGGGCTGGGG - Intronic
1062344014 9:136106584-136106606 TGGGGGCCTCAGCTGGCCCTTGG + Intergenic
1062624627 9:137437167-137437189 TGGGGGCCACGGCTGGCATGAGG - Exonic
1062701340 9:137906023-137906045 TGGAGGCCTCAGAGGCCCAGTGG + Intronic
1203638671 Un_KI270750v1:137322-137344 TGGGAGCCTCACCCGGCCTGGGG - Intergenic
1186281196 X:7995012-7995034 TGGGTGCCTCGGATGGAGTGTGG + Intergenic
1186482648 X:9907749-9907771 AGGGGGCCAGAGTTGGCCTGTGG - Intronic
1187679225 X:21750041-21750063 TGGGGCCCTAAGGAGGCCTGTGG + Intronic
1189775261 X:44464800-44464822 TGGGTGGCTCAGAAGGGCTGGGG - Intergenic
1190292097 X:48999916-48999938 TGGGGGCCTCTGATGGCAGGGGG + Intronic
1190456867 X:50635391-50635413 TGGGGGCCTTAGTTGGCCCTGGG + Exonic
1190917881 X:54823724-54823746 GCAGGGACTCAGATGGCCTGTGG - Intergenic
1190988354 X:55521299-55521321 TAGGGACCTCAGAGGTCCTGAGG + Intergenic
1198368023 X:135962631-135962653 TGGGGAGCTCACCTGGCCTGAGG + Exonic