ID: 1164706304

View in Genome Browser
Species Human (GRCh38)
Location 19:30322810-30322832
Sequence TGGCCTGCGGTCCTGCCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 162}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164706289_1164706304 23 Left 1164706289 19:30322764-30322786 CCTGCCCACCGAGCCCCTTACTC 0: 1
1: 0
2: 1
3: 11
4: 213
Right 1164706304 19:30322810-30322832 TGGCCTGCGGTCCTGCCTCATGG 0: 1
1: 0
2: 4
3: 18
4: 162
1164706297_1164706304 8 Left 1164706297 19:30322779-30322801 CCTTACTCTCACTCCTAGTGGGG 0: 1
1: 0
2: 0
3: 7
4: 127
Right 1164706304 19:30322810-30322832 TGGCCTGCGGTCCTGCCTCATGG 0: 1
1: 0
2: 4
3: 18
4: 162
1164706292_1164706304 15 Left 1164706292 19:30322772-30322794 CCGAGCCCCTTACTCTCACTCCT 0: 1
1: 0
2: 2
3: 40
4: 470
Right 1164706304 19:30322810-30322832 TGGCCTGCGGTCCTGCCTCATGG 0: 1
1: 0
2: 4
3: 18
4: 162
1164706293_1164706304 10 Left 1164706293 19:30322777-30322799 CCCCTTACTCTCACTCCTAGTGG 0: 1
1: 0
2: 2
3: 28
4: 298
Right 1164706304 19:30322810-30322832 TGGCCTGCGGTCCTGCCTCATGG 0: 1
1: 0
2: 4
3: 18
4: 162
1164706287_1164706304 27 Left 1164706287 19:30322760-30322782 CCCTCCTGCCCACCGAGCCCCTT 0: 1
1: 0
2: 3
3: 37
4: 362
Right 1164706304 19:30322810-30322832 TGGCCTGCGGTCCTGCCTCATGG 0: 1
1: 0
2: 4
3: 18
4: 162
1164706290_1164706304 19 Left 1164706290 19:30322768-30322790 CCCACCGAGCCCCTTACTCTCAC 0: 1
1: 0
2: 1
3: 5
4: 108
Right 1164706304 19:30322810-30322832 TGGCCTGCGGTCCTGCCTCATGG 0: 1
1: 0
2: 4
3: 18
4: 162
1164706291_1164706304 18 Left 1164706291 19:30322769-30322791 CCACCGAGCCCCTTACTCTCACT 0: 1
1: 0
2: 4
3: 10
4: 191
Right 1164706304 19:30322810-30322832 TGGCCTGCGGTCCTGCCTCATGG 0: 1
1: 0
2: 4
3: 18
4: 162
1164706295_1164706304 9 Left 1164706295 19:30322778-30322800 CCCTTACTCTCACTCCTAGTGGG 0: 1
1: 0
2: 1
3: 11
4: 146
Right 1164706304 19:30322810-30322832 TGGCCTGCGGTCCTGCCTCATGG 0: 1
1: 0
2: 4
3: 18
4: 162
1164706301_1164706304 -5 Left 1164706301 19:30322792-30322814 CCTAGTGGGGGCCTCAGATGGCC 0: 1
1: 0
2: 1
3: 14
4: 130
Right 1164706304 19:30322810-30322832 TGGCCTGCGGTCCTGCCTCATGG 0: 1
1: 0
2: 4
3: 18
4: 162
1164706288_1164706304 26 Left 1164706288 19:30322761-30322783 CCTCCTGCCCACCGAGCCCCTTA No data
Right 1164706304 19:30322810-30322832 TGGCCTGCGGTCCTGCCTCATGG 0: 1
1: 0
2: 4
3: 18
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164706304 Original CRISPR TGGCCTGCGGTCCTGCCTCA TGG Intronic
901688491 1:10957879-10957901 TGGCCTGCCGTCCTGCCTCCTGG - Intronic
902979180 1:20110756-20110778 TGGCCTGCGGGCTGGCATCATGG + Intergenic
903827431 1:26156186-26156208 TTGCCTGAGGTCCTGGCTCTAGG + Intergenic
903830504 1:26171436-26171458 TGGACGCCGGTCCTGCCCCAGGG + Exonic
903889259 1:26558704-26558726 GGGCCTCCAGACCTGCCTCAGGG - Intronic
903995236 1:27301244-27301266 TGCCCTGAGGGACTGCCTCAAGG + Exonic
916561007 1:165934088-165934110 GGGCCAGCTGTCCTGCATCAGGG + Intergenic
916571608 1:166033004-166033026 TGGCCTGAGGTCCTCCCACCTGG - Intergenic
917353016 1:174097590-174097612 TGGCTAGCAGCCCTGCCTCAGGG - Intergenic
918755922 1:188339244-188339266 TGTAGTGCGGTCCTTCCTCAAGG + Intergenic
919583871 1:199411080-199411102 TGGCCTGCCTTCCTTCCTCAAGG + Intergenic
923002962 1:230022839-230022861 TGGTCTCCTTTCCTGCCTCAGGG - Intergenic
1063096921 10:2916256-2916278 GGGGCTGTGGTCCTGCCTCCTGG - Intergenic
1066620588 10:37345173-37345195 TGCTCTGGGGTCCTGCCACAGGG + Intronic
1066623844 10:37385710-37385732 TGCCCTGAGGTCCTGCCACAGGG + Intergenic
1067469330 10:46524674-46524696 TGGCCTGGCATCCTGCCCCAAGG + Intergenic
1069636158 10:69926111-69926133 TGGCCAGTTATCCTGCCTCAGGG + Intronic
1069856277 10:71442889-71442911 TGCCCTCCAGTCCTGCCTCCCGG - Intronic
1069874329 10:71552414-71552436 TGCCCTGCAGTCCTGGCACATGG + Intronic
1069925000 10:71843269-71843291 TGGCCTGCTGTCCAGCCTTCTGG - Intronic
1076713336 10:132351024-132351046 TGTCCTGCGGGCTTCCCTCAAGG + Intronic
1077315189 11:1916551-1916573 TGGCCTTTGGGCCTGCCTCTCGG - Intergenic
1078338672 11:10483685-10483707 TGGCCTGTGGCCGTGCCTGATGG + Intronic
1081800146 11:45852981-45853003 TGGCCTGTGGTGCTCCCTAATGG + Intronic
1085274587 11:75290108-75290130 TGGTCCCCAGTCCTGCCTCAAGG - Intronic
1085509395 11:77080477-77080499 TGGCCTTGGCTTCTGCCTCAAGG + Intronic
1085931176 11:81085710-81085732 TGGGCTGCGGGGCTCCCTCAGGG + Intergenic
1089677342 11:120098716-120098738 GGTCCTGCAGCCCTGCCTCAGGG + Intergenic
1090418463 11:126557127-126557149 TGGCCTGGGGACCTGACCCAGGG - Intronic
1090778315 11:129984469-129984491 CGGCCTGCAGTCCAGCCCCACGG + Intronic
1090962545 11:131569993-131570015 TGGCCTGTGGTCCCCACTCAGGG + Intronic
1093032063 12:14297424-14297446 TGTAGTGCGGTCCTTCCTCAAGG + Intergenic
1095102935 12:38202188-38202210 TGGCCTGAAGTTCTGCCCCAAGG - Intergenic
1101990205 12:109477788-109477810 GGGCCTGCGGTCCGGCCTGCGGG + Exonic
1102214954 12:111154377-111154399 TGGCCTGGGCTCCTGCCTGGTGG - Intronic
1102955464 12:117055771-117055793 GGGGCTGAGGTCTTGCCTCATGG - Intronic
1103487995 12:121296134-121296156 TGGCCTAGGGTCCTGCCACCTGG + Intronic
1103999794 12:124853212-124853234 TCACATGCTGTCCTGCCTCAGGG - Intronic
1104952634 12:132448687-132448709 TGGACTGGGGTCCTTCCACAAGG - Intergenic
1107750909 13:43565462-43565484 TGGCCTGGGGTTCTCTCTCATGG + Intronic
1113286651 13:108857055-108857077 TCGCCTGCCTTCCTGCATCAAGG + Intronic
1113588084 13:111479478-111479500 TCTCCTGCGGTCCAGCCTCCTGG - Intergenic
1114644558 14:24247606-24247628 TGGCCTGAGTTTCTGACTCATGG - Intergenic
1117323844 14:54650494-54650516 TGGACTGTGGTCATGCCTCGTGG + Intronic
1118321944 14:64758437-64758459 TGGCCTGAGGCCCTGCCTCAAGG + Intronic
1119127537 14:72141608-72141630 TGGCCTTGTGTCCTTCCTCACGG - Intronic
1119615163 14:76094226-76094248 TGGCCTGGGGTCTTGGCTGAGGG - Intergenic
1120562802 14:86017683-86017705 TATCCTGGGGTCCTTCCTCAAGG + Intergenic
1202905430 14_GL000194v1_random:68847-68869 TGGTCTGAGGTCCTGCATCTGGG + Intergenic
1127730563 15:61798093-61798115 TGGCCTCCAGAGCTGCCTCAGGG - Intergenic
1130102277 15:80903123-80903145 TGGCCAGAGGACCTTCCTCAGGG - Intronic
1131071870 15:89471197-89471219 TGGGCTGGGGTCTTGCTTCAAGG - Intergenic
1131405424 15:92160501-92160523 TGGGCTGTGGTCCTGCCGAATGG - Intronic
1131679050 15:94702395-94702417 TGGCCTGCCATCCTGCTGCAGGG - Intergenic
1131804294 15:96105629-96105651 TGGCCTGTGCTCCTCGCTCATGG - Intergenic
1132766560 16:1537332-1537354 TGCCCTGAGGCCCTGCCCCATGG + Intronic
1133414974 16:5599369-5599391 TGCTCTGGGGTCCTGCATCATGG + Intergenic
1138414804 16:56865496-56865518 TGACCTGCACTCCTTCCTCAAGG + Exonic
1138436162 16:57001169-57001191 TGGCCTCAGGTCCTCCCCCAGGG + Intronic
1139884455 16:70198524-70198546 TGCTCAGCGGTCCTGGCTCACGG + Intergenic
1140217781 16:73022318-73022340 TGGCTTGCAGGCCTGACTCAGGG - Intronic
1140406363 16:74714018-74714040 AGGAGGGCGGTCCTGCCTCAGGG + Exonic
1140487393 16:75304504-75304526 TGGCCTGGGGTGCTGTCTGAGGG + Intronic
1141649935 16:85387407-85387429 TGCTCTGTGGTCCTGCCCCAGGG + Intergenic
1141679570 16:85536382-85536404 TGGCCGACCGTCCTGCCTCCTGG - Intergenic
1147739518 17:42663014-42663036 TGGCCTGGGCTCCTACCTCCTGG + Exonic
1152465594 17:80464448-80464470 TGGCCTGCAGTCCTGCGTGGGGG + Intergenic
1152632012 17:81414659-81414681 CGGCCAGCGCTCCTGCCGCACGG - Intronic
1152701797 17:81823164-81823186 TGTCCTGTGGTCCTGCCCCTGGG - Intronic
1153983748 18:10334732-10334754 TTGCCTACGGTCCTGCCGTAAGG + Intergenic
1155994207 18:32312824-32312846 TGGCCTGTGCTCCTGTCTGAAGG - Intronic
1157860181 18:51134044-51134066 TGGACTGCGGACCTTCCCCACGG - Intergenic
1159485782 18:69055531-69055553 TGACCTGCGGCCCATCCTCAAGG - Intergenic
1159957095 18:74526360-74526382 TGCCCTGGGGTCATCCCTCAGGG + Intergenic
1160332067 18:78003064-78003086 TGGGCTGCGGTCCAGCCATACGG - Intergenic
1161057295 19:2197101-2197123 TGGCCTGCGGTGCTTCCTTGCGG + Intronic
1161240838 19:3222892-3222914 TCAGGTGCGGTCCTGCCTCAGGG - Intergenic
1161533843 19:4806598-4806620 TTGGGTGCGGTCCTGCCTCAGGG - Intergenic
1162064513 19:8117018-8117040 TGGCCTGTGGTCCTGGCCCCAGG - Intronic
1162293858 19:9799374-9799396 TGTCCTGCCTTCCTGCCTCAGGG + Intergenic
1162308515 19:9890389-9890411 TGGCCTCCTGCCCTGCCTCAAGG + Intronic
1163391926 19:17036397-17036419 GGGGCTGCGGTGGTGCCTCAAGG - Intergenic
1163475715 19:17525062-17525084 TGACCTGCCCGCCTGCCTCAGGG + Intronic
1164706304 19:30322810-30322832 TGGCCTGCGGTCCTGCCTCATGG + Intronic
1164732817 19:30519085-30519107 CGGCCTGAGGTGCTGCCCCAGGG + Intronic
1165315166 19:35050635-35050657 TTTCCTGCTGTCCTGCATCAGGG - Intronic
1166107121 19:40602812-40602834 TGGCCTGCGGGCCTGCATTCAGG + Intronic
1166895830 19:46021547-46021569 TGGGCTGCAGTCCAGCCTGACGG - Intronic
1167048389 19:47065042-47065064 AGGCCTGCTATCCTGCCTCTGGG - Exonic
1168688923 19:58365325-58365347 TGGCCTGTGGTTCTGGCTCAAGG - Intergenic
1202632606 1_KI270706v1_random:14361-14383 TGGCCTGCGGCAGTGGCTCATGG - Intergenic
930456465 2:51613238-51613260 TGTACTGGGGTCCTTCCTCAGGG + Intergenic
931017917 2:58006968-58006990 TGTACTGGGGTCCTTCCTCAAGG - Intronic
934534067 2:95118401-95118423 TGGCCTACAGGCCTGCCACATGG + Intronic
935371788 2:102355672-102355694 CGGCCAGCGGTCCTCCCTCCTGG + Intronic
937029340 2:118725180-118725202 TGGCCTGCAGTCCTGTCTTTGGG - Intergenic
937958771 2:127438673-127438695 AGGGCTGCAGTCCTGCCTCAGGG + Intronic
938721553 2:134071542-134071564 AGGCCTGCGTTCCTGTCTCAGGG - Intergenic
942060825 2:172227250-172227272 TGGCTTTCTGTCCTGCCGCAGGG - Intergenic
946812087 2:223536600-223536622 TTGCATGGGTTCCTGCCTCAGGG + Intergenic
948570281 2:238913358-238913380 TGGCCAGCGGCCCTCCCTCAAGG - Intergenic
948627178 2:239276368-239276390 TGGCCTGGGGTCCAGACACAGGG - Intronic
948664049 2:239523595-239523617 GGGCCTGGGGTCCTGCTGCAGGG - Intergenic
948908181 2:240989749-240989771 TGGCCTGCGGCCGGGCCCCATGG - Intronic
1170914039 20:20605319-20605341 TGGTGTGCTGTCCTCCCTCACGG - Exonic
1171484886 20:25479414-25479436 TTGCCTGCCGCCCTGCCTCAGGG - Intronic
1173400706 20:42723530-42723552 TGGCCTGTGGTCTATCCTCAGGG + Intronic
1173684963 20:44916809-44916831 TGGCCTGCTGTGCGGCCTCATGG - Exonic
1173707568 20:45123887-45123909 TGGCCTCCCATCCTGGCTCAGGG + Exonic
1173797798 20:45874758-45874780 TGCCCTCTTGTCCTGCCTCAGGG + Intronic
1175911957 20:62409250-62409272 TGGGGTGCGGGCCTGACTCAGGG - Intergenic
1176384811 21:6134055-6134077 TGGCCCGAGGACCTGGCTCAGGG - Intergenic
1178395032 21:32235479-32235501 TTGCCTGAGGTTCTGCTTCAGGG + Intergenic
1178492129 21:33059246-33059268 TGGGATGCGGTCCAGCCTCATGG - Intergenic
1179108187 21:38422258-38422280 CACCCTGCGGTCCTGCCTCAGGG - Intronic
1179458399 21:41515593-41515615 TGTCCTGGGATCCTTCCTCAAGG + Intronic
1179627782 21:42658287-42658309 TGGTCTGTGGTCCTGGCCCAAGG + Intronic
1179738661 21:43404197-43404219 TGGCCCGAGGACCTGGCTCAGGG + Intergenic
1181284352 22:21741255-21741277 TGGCCTGCGCACCTGCTTCTGGG - Intergenic
1182024749 22:27109130-27109152 TGGCCTGCGCTGCTGCTTCCTGG - Intergenic
1182895314 22:33854948-33854970 TGCCTTGTGGTCCTGCCTCTGGG - Intronic
1183573915 22:38674970-38674992 TCGCCTGCCCTCCTGCTTCATGG + Intergenic
1184413506 22:44339006-44339028 TGGCCTGCCCACCTGCCTCTTGG + Intergenic
1185147693 22:49148181-49148203 TGGCCTGGGGTCCTTCCTCATGG - Intergenic
952920747 3:38282354-38282376 TGGCTTGCGGTCCTGCCTACAGG + Intronic
953850957 3:46465036-46465058 TGGAGTCCTGTCCTGCCTCAGGG - Exonic
954899214 3:54004649-54004671 TCGCCTGCTGGCCTGCCCCATGG - Intergenic
954969718 3:54641113-54641135 TGTCCTGGGGTGCAGCCTCAAGG + Intronic
956877731 3:73480060-73480082 TGGCCTCAGGTCCTACCCCAAGG - Intronic
958930837 3:100206216-100206238 TGGCCTGAGCTCCTGACTGAAGG - Intergenic
967371153 3:188747865-188747887 TGGCCTTAGGTCCTGCCTCATGG + Intronic
968733868 4:2285209-2285231 TGGGCTGCCTTCCAGCCTCAGGG - Intronic
969635915 4:8369512-8369534 GGGCCTGCTGTCCTGCATCGGGG - Intronic
980406090 4:132355275-132355297 TGTAGTGCGGTCCTTCCTCAAGG + Intergenic
983965871 4:173809126-173809148 TGGCCTGTTGTCCTGTCTCAGGG + Intergenic
986782269 5:11077459-11077481 TGCTCTGAGATCCTGCCTCAGGG - Intronic
988557632 5:32251391-32251413 TGGCCTGCTGACCTCCTTCATGG - Intronic
990237227 5:53781332-53781354 GGGCCTGGGGTCCTCCCTGAGGG - Intergenic
991396435 5:66209232-66209254 TGGCCTGAGCTGCTGCCTGATGG - Intergenic
991596952 5:68315892-68315914 AGGCCTGCTGTACTGCCTCCGGG + Intergenic
992945402 5:81804087-81804109 TGGCCTGAGGGCATGTCTCATGG - Intergenic
997449017 5:133967235-133967257 TGGACAGCAGTCCTTCCTCAGGG + Intronic
999187700 5:149725026-149725048 TGGCCTGAGTCCCTGCCTCCTGG + Intergenic
999349246 5:150851458-150851480 TGGCCTGCCGTCGTGCATTAGGG - Intronic
1001144456 5:169171661-169171683 TGGGCTGCATTCCAGCCTCAGGG - Intronic
1002659691 5:180783412-180783434 GGGCCTTGAGTCCTGCCTCAGGG - Intergenic
1004001382 6:11600152-11600174 ACACCTGGGGTCCTGCCTCAAGG + Intergenic
1007726406 6:43918614-43918636 TGGTCTAGGGTCCTACCTCATGG + Intergenic
1011655680 6:89549738-89549760 TGCCCTGCACTCCTGCCTCTGGG + Intronic
1017757640 6:157542944-157542966 GGGCCTGCAGTCCTGCCTCCAGG - Intronic
1018818079 6:167350858-167350880 TGGCCTGCGCTTCTGCTTCTAGG - Intronic
1018978813 6:168585699-168585721 AGGCATGTGGTGCTGCCTCATGG + Intronic
1019404413 7:876291-876313 TTGCCTGCGGACCCGCCTCTGGG + Intronic
1019404421 7:876321-876343 TTGCCTGCGGACCCGCCTCTGGG + Intronic
1019404428 7:876351-876373 TTGCCTGCGGACCCGCCTCTGGG + Intronic
1019576501 7:1740174-1740196 GGGCCTGGCCTCCTGCCTCAGGG - Intronic
1019624994 7:2011478-2011500 TGGGCTGGGTTCCTGCCTCAGGG - Intronic
1019932579 7:4233797-4233819 GGGCCTGGGGTCCTGCCAGAGGG - Intronic
1020212083 7:6165094-6165116 GAGCCTGCGGTCCTGTCTGAGGG - Intronic
1029113560 7:98225101-98225123 TGCCCTGTTGTCCTGCCGCAGGG - Exonic
1034931052 7:155164454-155164476 TGGCGGGTGGTCCTGGCTCAGGG + Intergenic
1035310139 7:157962481-157962503 TGGTCTGCTGTCCTGGATCAGGG - Intronic
1035918905 8:3655603-3655625 TGGCTTGCAGCCCTGCCTGAGGG - Intronic
1045370234 8:101515610-101515632 TGCACTGCGGGCATGCCTCACGG - Intronic
1049567536 8:143348844-143348866 CGGGCTGGGCTCCTGCCTCAGGG - Intronic
1049989367 9:977106-977128 TGGCGTCCTGTCCTGGCTCAAGG + Exonic
1052264885 9:26560760-26560782 TAGACTGGGGTCTTGCCTCAGGG - Intergenic
1059400057 9:114063310-114063332 TGCCCTGGGATCCTGCCTCAAGG - Intronic
1059637238 9:116183019-116183041 TGGCCTTCGGTTTTGCCACATGG + Intronic
1060821443 9:126663859-126663881 TGGCCTGCTGCCCCGCCCCATGG - Intronic
1061588705 9:131584433-131584455 CCGCCTGCCCTCCTGCCTCACGG - Intronic
1061780151 9:132991082-132991104 TGCCCTGCGGTCCTGTCACCTGG + Exonic
1061884180 9:133583340-133583362 TGGGCTGAGGTGCTCCCTCAGGG + Intronic
1061973134 9:134055386-134055408 TGACTTGCGGCCCTCCCTCAAGG + Intronic
1062741094 9:138175673-138175695 TGGCCTGAGGACCTGCCCGAAGG - Intergenic
1189033840 X:37476279-37476301 TGAACTGGGGTCCTTCCTCAAGG + Intronic
1190106677 X:47566237-47566259 TGGCCTGCTATCCTGCCTTTAGG + Intronic
1193467840 X:81869076-81869098 TGGCTTGCTGCCCTGCCTAAGGG + Intergenic
1194760234 X:97787958-97787980 TGGCCTTCGTTCCTGTCTCCTGG + Intergenic
1195712136 X:107781300-107781322 TGGCCTGCCTGCCTGCCTGAAGG + Intronic
1196057737 X:111374226-111374248 TGCCCTTCAGTCCTGCCACAGGG - Intronic
1199008362 X:142729513-142729535 TGTACTGAGGTCCTTCCTCAAGG - Intergenic
1199767060 X:150948928-150948950 GGGCCAGGGGTCCTTCCTCAGGG + Intergenic
1199949712 X:152698507-152698529 GGGCCTTCGGTCATCCCTCAGGG - Intergenic
1199959962 X:152769954-152769976 GGGCCTTCGGTCATCCCTCAGGG + Intergenic