ID: 1164712896

View in Genome Browser
Species Human (GRCh38)
Location 19:30371281-30371303
Sequence TGACATAAACAAAGGCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 281}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164712893_1164712896 -2 Left 1164712893 19:30371260-30371282 CCTGTGGCACGAGAGGATAAGTG 0: 1
1: 0
2: 0
3: 3
4: 84
Right 1164712896 19:30371281-30371303 TGACATAAACAAAGGCAGCTGGG 0: 1
1: 0
2: 2
3: 18
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164712896 Original CRISPR TGACATAAACAAAGGCAGCT GGG Intronic
900468531 1:2838239-2838261 TGACATAAGCAAAGGTTGGTGGG - Intergenic
900636295 1:3667453-3667475 AGGCATAAACGAGGGCAGCTGGG + Intronic
900907058 1:5566807-5566829 TGCCATAAATAAAGTGAGCTTGG + Intergenic
901543509 1:9937545-9937567 AGAAAAAAAAAAAGGCAGCTGGG + Intronic
902221548 1:14969090-14969112 TGACATCTGCAAAGGCAGCCAGG - Intronic
904426073 1:30424033-30424055 TGAAATAAACACAAACAGCTCGG + Intergenic
905262133 1:36727292-36727314 TGACCCAAACAAGGGCAGTTTGG + Intergenic
905938106 1:41840760-41840782 CGACATAACCAGAGGAAGCTTGG + Intronic
907177466 1:52538365-52538387 TGAGAAAAAAAAAGGGAGCTGGG + Intronic
910341682 1:86195377-86195399 TGAAAGAATCAAAAGCAGCTGGG + Intergenic
910710689 1:90176783-90176805 TTACCTAAATAAAGGCAGCTTGG + Intergenic
912020767 1:105106915-105106937 AGAAATGAACAAAGACAGCTTGG + Intergenic
912185991 1:107276411-107276433 TGGCATAAGCAAAGGCAGGAGGG - Intronic
913197282 1:116468012-116468034 TGACATAAGCAAAGAGAACTAGG - Intergenic
913476079 1:119239369-119239391 TGACATAAACAAAGGCAAAAAGG - Intergenic
914601058 1:149206494-149206516 TGATACAAACAACCGCAGCTCGG + Intergenic
915219812 1:154365730-154365752 TCACATAAACAAAGGCTCGTTGG + Intergenic
916002108 1:160626916-160626938 TGACACAAAGAAAGGAAGATTGG - Intronic
918251178 1:182704750-182704772 TGCCATAATCAAGGACAGCTTGG - Intergenic
919024213 1:192147442-192147464 AGGAATAAACAAGGGCAGCTTGG - Intergenic
921849578 1:219920504-219920526 TTATATAAACAAAGGCAATTTGG - Intronic
922187995 1:223293285-223293307 TGAAATTAAGAAAGGCAGCCGGG - Intronic
922231839 1:223693995-223694017 TTACATAAATAAGGGCAGATAGG - Intergenic
922855157 1:228768899-228768921 TGACAGATACAAAGGCAGCATGG + Intergenic
923829050 1:237534678-237534700 AGAAATAAACAAAGGCAGAGTGG - Intronic
1063353840 10:5380239-5380261 TGATAAAAACAATGGCAGGTGGG - Intergenic
1063980538 10:11448255-11448277 TGAAATAAACGAAGTCTGCTGGG + Intergenic
1065959567 10:30723545-30723567 TAACAGAAAGAAAGGCAGCGCGG + Intergenic
1066747712 10:38617758-38617780 TCACCTAAACAAATGCAGTTTGG - Intergenic
1067104444 10:43356720-43356742 AGGAATGAACAAAGGCAGCTTGG + Intergenic
1068114578 10:52723172-52723194 TAAAATAAACAAAGTTAGCTGGG + Intergenic
1070019082 10:72565975-72565997 TGAAATTAACAAAGGAACCTTGG - Intronic
1070648601 10:78219059-78219081 AGGCAGAAACAAAGGCAGCAAGG - Intergenic
1071429725 10:85597295-85597317 TGACATAAGCAAATGGAGATAGG - Intergenic
1074557045 10:114500822-114500844 TTAAATAAACAAAGGCAAGTTGG + Intronic
1078465483 11:11547001-11547023 TTTCAAACACAAAGGCAGCTTGG + Intronic
1078513588 11:12005021-12005043 TGATAGAAAAAAACGCAGCTGGG + Intronic
1078949755 11:16117052-16117074 TAAAACAAGCAAAGGCAGCTGGG + Intronic
1079528300 11:21417035-21417057 GGACACAAACCAAGGCAGCATGG + Intronic
1079645013 11:22852248-22852270 TGGAATAACCAAGGGCAGCTGGG - Intronic
1079817154 11:25076177-25076199 GAACAAAAACAAAAGCAGCTGGG - Intronic
1079951199 11:26807333-26807355 TTACATAAAAAAAGGAAACTTGG - Intergenic
1080437183 11:32255922-32255944 TCACATAAACAAAGGGGGGTGGG + Intergenic
1081518320 11:43856027-43856049 ATGCAGAAACAAAGGCAGCTGGG - Exonic
1081805448 11:45887476-45887498 TGAGATTAACAAAGGCAGGGTGG + Intronic
1082274630 11:50208139-50208161 AGGAATGAACAAAGGCAGCTTGG - Intergenic
1083451863 11:62751628-62751650 TCAAAAAAAAAAAGGCAGCTGGG + Exonic
1083794479 11:65007100-65007122 TTACATATCCAAAGGCAGCCAGG - Intergenic
1085788132 11:79473010-79473032 TGAGATTAACAAAGGCGGCGTGG + Intergenic
1086389475 11:86347560-86347582 TGACATAAATAATGCCGGCTGGG + Intergenic
1087050478 11:93881854-93881876 AGGAATAAACAAAGACAGCTTGG - Intergenic
1088242474 11:107786323-107786345 AGGAATAAACAAAGACAGCTTGG + Intergenic
1088530610 11:110804380-110804402 TGGCTTAAAAGAAGGCAGCTGGG - Intergenic
1089231314 11:116979519-116979541 TCACATAAACAAAAGCAATTTGG + Intronic
1089371970 11:117967479-117967501 TTACAAAAACAAAAACAGCTGGG + Intergenic
1090453467 11:126827040-126827062 AGACAAAATTAAAGGCAGCTTGG - Intronic
1090982928 11:131739264-131739286 TGAAATAAACAAAAGAAGATGGG + Intronic
1091503357 12:1041046-1041068 CTACATAAACAAAAGCTGCTTGG - Intronic
1091908680 12:4211011-4211033 TAACATAAACACAAACAGCTGGG - Intergenic
1096555238 12:52399819-52399841 TGGCAGAAACAACAGCAGCTGGG + Intronic
1097915197 12:65013761-65013783 AGACATAACCAAATGCAGCAGGG + Intergenic
1100099946 12:91091487-91091509 TGAAAAAAACCAAGGCAGATAGG - Intergenic
1100635902 12:96434212-96434234 TAAAATAAATAAAGCCAGCTGGG - Intergenic
1100719121 12:97338629-97338651 TGGCATCAACAAAGGCCACTAGG + Intergenic
1102612849 12:114127956-114127978 TGAGAAAAACCAAGGCATCTTGG + Intergenic
1103037041 12:117664985-117665007 TAACAGAAACAGAGGCAGCCTGG - Intronic
1103714719 12:122938071-122938093 TGACAGAAACTACGGCAGTTGGG + Intronic
1103783548 12:123415423-123415445 TCACATAAAGAAAGGCATGTTGG + Exonic
1104899991 12:132184219-132184241 TGAAAAGAACAAGGGCAGCTGGG - Intergenic
1106184774 13:27399728-27399750 TGACTTAAAGAAAGGAAGTTAGG + Intergenic
1106251975 13:27988888-27988910 TCCCATAATCAAAGGCAGCAGGG + Intergenic
1106440117 13:29759106-29759128 TGACTTGAACCAAGGTAGCTGGG + Intergenic
1106446587 13:29838164-29838186 TAACATAAACAGTGGCAGCCAGG + Intronic
1107236433 13:38176183-38176205 AGGAATGAACAAAGGCAGCTTGG + Intergenic
1107554524 13:41506018-41506040 TGAGATAAACTGAGGCTGCTTGG + Intergenic
1108066553 13:46583542-46583564 TGACATTAGCACAGGCAGCCAGG - Intronic
1108228400 13:48314226-48314248 TGTTTTAAAAAAAGGCAGCTGGG + Intronic
1108980236 13:56501916-56501938 AGACTTAAACAAAGAAAGCTGGG - Intergenic
1109595506 13:64548638-64548660 TGACTTAAAACATGGCAGCTTGG + Intergenic
1110259678 13:73471445-73471467 TGGCATGAACAAAGGCAGAGTGG + Intergenic
1110953925 13:81529401-81529423 AGGAATGAACAAAGGCAGCTTGG - Intergenic
1111529486 13:89518299-89518321 AGTAATGAACAAAGGCAGCTTGG + Intergenic
1111698458 13:91656159-91656181 TAACAGAAACAGAGGCAGCGTGG + Intronic
1112342372 13:98563306-98563328 AGAGATAAACACAGGCAGTTGGG + Intronic
1115834451 14:37382827-37382849 TGAAACAAAAAAAGGCATCTTGG + Intronic
1115893276 14:38056641-38056663 AGAAATAAACAAGGACAGCTTGG - Intergenic
1117168156 14:53060726-53060748 TGGCATAAACAAAGGCATAGAGG - Intronic
1117445630 14:55801346-55801368 GGGAATAAACAAAGGCAGCTTGG - Intergenic
1118093337 14:62507792-62507814 TGACATAACCAAATGGAACTAGG - Intergenic
1118295396 14:64563602-64563624 TGACAGTAATAAAGTCAGCTTGG - Intronic
1118538603 14:66797185-66797207 TGACATAAAAACAGACACCTAGG - Intronic
1118826131 14:69383526-69383548 GGACATAACCAAAGTCACCTGGG + Intronic
1121352909 14:93187946-93187968 TAACATAAATAAATACAGCTAGG - Intronic
1123144017 14:106110561-106110583 TAAAATGAACAAAGGCAGCAAGG + Intergenic
1126155831 15:45564890-45564912 AGATATAAACAAAGGCTGGTGGG + Intergenic
1127314502 15:57781897-57781919 GGACATGAAGAAAGGCACCTGGG - Intronic
1129615181 15:77093510-77093532 TGACATAAAGAAAGCAAGGTAGG - Intergenic
1132131276 15:99282396-99282418 AGATATTAACAAAGGCAACTAGG - Intronic
1133908401 16:10042290-10042312 TGACATCAACAAAGGCAATGTGG + Intronic
1134328372 16:13227852-13227874 AGACAGAAAAGAAGGCAGCTTGG + Intronic
1135208487 16:20503326-20503348 CAACAGAAACAAAGGAAGCTAGG + Intergenic
1135230831 16:20706377-20706399 CTACAGAAACAAAGGAAGCTAGG + Intronic
1135462880 16:22660272-22660294 TTACAAAAACAAGGGCAGGTGGG + Intergenic
1135959342 16:26982840-26982862 AGAAATAAACAAGGACAGCTTGG - Intergenic
1136356507 16:29747750-29747772 AGGAATAAACAAAGACAGCTTGG - Intergenic
1136735101 16:32459828-32459850 TCACCTAAACAAATGCAGTTTGG + Intergenic
1138964681 16:62070077-62070099 TGACAAGAACATAGGCATCTTGG + Intergenic
1139335168 16:66226395-66226417 TGACATCAGCAGAGGCGGCTGGG - Intergenic
1140313225 16:73868826-73868848 TGACATAAAAATATGGAGCTTGG - Intergenic
1141661553 16:85444311-85444333 GGACATAAGCAAAGGCAACCAGG + Intergenic
1142132698 16:88438144-88438166 TGCCATCAGCCAAGGCAGCTGGG - Exonic
1203017978 16_KI270728v1_random:369765-369787 TCACCTAAACAAATGCAGTTTGG - Intergenic
1203036313 16_KI270728v1_random:642923-642945 TCACCTAAACAAATGCAGTTTGG - Intergenic
1144218906 17:13082269-13082291 TGACAAAAACAAAAACAGGTTGG + Intergenic
1144659525 17:17059212-17059234 TGCCATAATGAAAGACAGCTGGG + Intronic
1146144566 17:30401779-30401801 AGACAGAAAAAAAGTCAGCTGGG - Intronic
1149245547 17:54701638-54701660 TGATACAAAAAAAGGCTGCTGGG - Intergenic
1150078257 17:62212775-62212797 AGCCATAAAAAAAGGCAGATTGG - Intergenic
1150714337 17:67558729-67558751 TGACAGAAGCAAAGGCAGATGGG + Intronic
1150897706 17:69233676-69233698 GGATATAAACAAAGCCAGATTGG - Intronic
1151824470 17:76516226-76516248 AAACAAAAACAAAGGCAGCCGGG - Intergenic
1152330064 17:79667637-79667659 TGAGATAAACGAAGACAGATGGG + Intergenic
1153322955 18:3791749-3791771 TGAAATAAGCAAATGAAGCTGGG + Intronic
1153739521 18:8108910-8108932 TTTAATAAACAAAGGCAGCATGG + Intronic
1155322120 18:24630042-24630064 TGCCAGAAACAAAGGCAGCTGGG - Intergenic
1157449463 18:47774318-47774340 TGACATAAACAATGGCACAGAGG + Intergenic
1158202030 18:54951773-54951795 TTCCATGAACAAAGGCAGTTTGG + Intronic
1158228270 18:55223542-55223564 AGACAAAAACAAACCCAGCTTGG - Intronic
1158719070 18:59907663-59907685 AGCCAAAAACAAAGGCAGCTGGG - Intergenic
1164712896 19:30371281-30371303 TGACATAAACAAAGGCAGCTGGG + Intronic
1166069581 19:40379289-40379311 TGAAATAGACAGAGGCAGCAGGG + Exonic
1168390988 19:56007784-56007806 TGAGATAAATAAAGGTGGCTTGG + Intronic
925429828 2:3781707-3781729 TGAAATAAAAAAAGGTAGCCAGG + Intronic
926034902 2:9629038-9629060 TGAGATGAAGAAAGGCGGCTTGG + Intronic
928713275 2:34031485-34031507 TGGCATAACCAAAAGCACCTGGG - Intergenic
929055654 2:37874147-37874169 TGACATAACCAGTGGCAGCTGGG + Intergenic
929295547 2:40242427-40242449 CAACATAAACACAGGCAGCATGG - Intronic
929476322 2:42253339-42253361 TGTCAAAAACATAGGCATCTTGG - Intronic
929750514 2:44707528-44707550 TGATATAAAGAAAGACAGCATGG + Intronic
931447409 2:62338289-62338311 GCACATAAACAAAGCCATCTGGG - Intergenic
933842548 2:86299077-86299099 TGATATCAACATAAGCAGCTTGG - Intronic
934310677 2:91859896-91859918 TCACCTAAACAAATGCAGTTTGG - Intergenic
935628154 2:105188382-105188404 TTACTTTAACAAAGTCAGCTTGG + Intergenic
935986991 2:108683779-108683801 TGAACTAAACGAAGGCAACTAGG - Intronic
937311023 2:120903547-120903569 TGGCATAACCACAGGCAGGTTGG + Intronic
937713183 2:125001655-125001677 TAACAGAAAGAAAGGAAGCTTGG + Intergenic
939468507 2:142588679-142588701 AGAGATGAACAAAGGCAGCCTGG + Intergenic
940266524 2:151844653-151844675 TGACATAAATAGAGGCATCGAGG + Intronic
940639586 2:156332696-156332718 CCACATAAACAAAGGCACATTGG - Exonic
941713031 2:168734737-168734759 GGACAAAAACAAAAGCAACTAGG + Intronic
942098184 2:172553566-172553588 AGGAATAAACAAGGGCAGCTTGG + Intergenic
943309396 2:186307992-186308014 TTACAGAAAGAATGGCAGCTTGG + Intergenic
943664980 2:190600010-190600032 TGACACACACAGGGGCAGCTAGG - Intergenic
944348631 2:198700534-198700556 TAAAATAAAAAAAGGCAGGTGGG + Intergenic
944887533 2:204079170-204079192 TGAAATAAACAAAGGACCCTTGG + Intergenic
944945015 2:204673931-204673953 TGATATAGACAAGGGCAGCATGG - Intronic
946215620 2:218181264-218181286 AGAAATAAACAATGACAGCTTGG + Intergenic
946864571 2:224031404-224031426 AAACAGAAAGAAAGGCAGCTGGG + Intronic
1168921250 20:1537927-1537949 TGACATGCAGAAACGCAGCTGGG + Intronic
1169580441 20:7016817-7016839 TGACATATACAGAGGCATTTAGG - Intergenic
1170368138 20:15619332-15619354 AGTAATAAACAAAGACAGCTTGG + Intronic
1171289395 20:23972838-23972860 TGAGTTAAACAAAGGGAGCCAGG - Intergenic
1171505369 20:25628648-25628670 TGACAAAGACAAAGGTGGCTGGG + Intergenic
1174044667 20:47725113-47725135 TGACAATTACAAGGGCAGCTGGG + Intronic
1175326592 20:58133464-58133486 CGATAAAAATAAAGGCAGCTTGG + Intergenic
1178580272 21:33832165-33832187 TGTCATGAACAAAGGCAGCAAGG - Intronic
1178914511 21:36699111-36699133 TGCCATAAACAAACGCGGCTCGG + Intronic
1178984243 21:37289402-37289424 TTAAATAAATATAGGCAGCTGGG - Intergenic
1180537428 22:16405829-16405851 TCACCTAAACAAATGCAGTTTGG - Intergenic
1180783736 22:18535629-18535651 TGACATAAATAGAGGCCCCTGGG + Intergenic
1181148069 22:20862861-20862883 ACACAAAAACAAAGACAGCTTGG - Intronic
1181240637 22:21474981-21475003 TGACATAAATAGAGGCCCCTGGG + Intergenic
1181431484 22:22884418-22884440 TGACATCTACAAAGGGAGCAGGG + Intronic
1183171131 22:36189109-36189131 TGACTTAAACAAGTCCAGCTTGG + Exonic
949489125 3:4571085-4571107 TGACACAAACAAAGGCTTCACGG - Intronic
950615825 3:14157408-14157430 TGCCATACACACAGGCGGCTCGG + Intronic
950668484 3:14511420-14511442 CGACATCAAGAAAGGCAGCGTGG - Exonic
954142926 3:48619669-48619691 CCATAGAAACAAAGGCAGCTAGG + Intergenic
955548934 3:60062020-60062042 TGACTCAAAATAAGGCAGCTGGG + Intronic
956054718 3:65286685-65286707 TGAAATAAACAAAGGCAACCAGG - Intergenic
957887559 3:86308171-86308193 TGACATGAAAAAAGGGAGCAAGG - Intergenic
958673451 3:97234225-97234247 GGAGATAAACAAAACCAGCTAGG - Intronic
958987079 3:100793779-100793801 TGACTTAAACAAAGCCATATGGG + Intronic
959126949 3:102301325-102301347 TGACACAATCAAACACAGCTGGG - Intronic
960085942 3:113591568-113591590 TGACATAAAGAAAGACATATGGG + Intronic
960839767 3:121945267-121945289 TAAAATATACAAAGGAAGCTAGG + Intergenic
961631222 3:128300169-128300191 GGACAAAGAGAAAGGCAGCTGGG - Intronic
962095320 3:132286798-132286820 AAAAATAAACAAAGGTAGCTGGG - Intergenic
962609819 3:137065623-137065645 AGGCATAGACAAAGGCAGGTGGG + Intergenic
964611541 3:158621136-158621158 TGATTTAAAAAAAGGCAGCCAGG - Intergenic
966533931 3:181009873-181009895 AGAAATGAACAAAGACAGCTTGG + Intergenic
968010120 3:195269058-195269080 TGACAAAAGCAAAGGCAAGTAGG + Intronic
968206508 3:196806964-196806986 TGAGATAAACAGAGAAAGCTTGG - Intronic
968397847 4:260012-260034 AGAGATAAAAGAAGGCAGCTGGG - Intergenic
969424143 4:7114103-7114125 CGACATGAACAAAGGCACCGAGG + Intergenic
970509353 4:16765349-16765371 TGACATATGCAAAGGCAGGGAGG - Intronic
971678981 4:29672518-29672540 TGAAATAAACATAGGAATCTTGG - Intergenic
972064808 4:34928280-34928302 TGACAGAAACAGTGGTAGCTGGG + Intergenic
973122589 4:46541103-46541125 TAACATAACCAAAGGAACCTAGG - Intergenic
973213648 4:47644270-47644292 TGACATTACCAAGGGCATCTGGG - Intronic
973882859 4:55291287-55291309 CTACATAAACAATGACAGCTGGG - Intergenic
974638674 4:64600164-64600186 TGCCATAAACAAAAGTAGTTTGG - Intergenic
978401844 4:108339490-108339512 TGACTTATAAAGAGGCAGCTTGG - Intergenic
978941155 4:114437276-114437298 TGACAAAAACAGAGGAAGGTTGG + Intergenic
982216404 4:153086159-153086181 TTACAAAAACAGAGGCAGCCAGG - Intergenic
982651732 4:158095626-158095648 TGACATAAGCAATGTCAGATAGG - Intergenic
983220001 4:165034907-165034929 TGACATAAATGTAGGCAGTTTGG + Intronic
984170791 4:176357148-176357170 AGACATACACAAACACAGCTTGG + Intergenic
984310114 4:178047079-178047101 AGGAATGAACAAAGGCAGCTTGG + Intergenic
984317724 4:178148608-178148630 AGGCATGAACAAGGGCAGCTTGG + Intergenic
984712064 4:182894129-182894151 TGTCAGAAACAAGGTCAGCTGGG - Intronic
986194176 5:5522563-5522585 AGGAATAATCAAAGGCAGCTGGG + Intergenic
988746302 5:34142134-34142156 TAAAAGAAACAGAGGCAGCTGGG + Intergenic
988971375 5:36471802-36471824 TGCCTGAAACAAAGGCAACTGGG - Intergenic
990081379 5:51918784-51918806 TGACATTAAAAAATTCAGCTGGG + Intergenic
990123037 5:52479536-52479558 AGGCATAAACAAAGGCAGCTTGG + Intergenic
993128380 5:83863467-83863489 TGATACAAACAAAGGGAGGTGGG + Intergenic
993421996 5:87714284-87714306 AGAAATGAACAAAGACAGCTTGG + Intergenic
993826064 5:92688330-92688352 TGACTTAAACAAGGCAAGCTAGG + Intergenic
995926413 5:117380315-117380337 TGCCATCACCAAAAGCAGCTGGG - Intergenic
996132487 5:119798453-119798475 AGACATGAACAAGGACAGCTTGG - Intergenic
996748767 5:126868527-126868549 TGACATCATCAAAGGCAGCCAGG - Exonic
997948849 5:138225833-138225855 AGGAATAAACAACGGCAGCTTGG - Intergenic
1003778912 6:9400569-9400591 TGGCATAAACAAAGGCATGGAGG - Intergenic
1005151300 6:22754333-22754355 TTACAAAAACACAGGCAGCAGGG - Intergenic
1005433292 6:25781099-25781121 TGGCATAAGAAAAGGAAGCTTGG + Exonic
1005544449 6:26850367-26850389 TAAAAGAAACAGAGGCAGCTGGG + Intergenic
1006688476 6:35858733-35858755 TGACATAAACCAAGAAAGATAGG + Intronic
1007642080 6:43349518-43349540 TAACATTAAAAAAGCCAGCTGGG - Intronic
1008717095 6:54301872-54301894 AGACAGAAACAAAGGCAGGAGGG + Intergenic
1009015237 6:57891995-57892017 TAAAAGAAACAGAGGCAGCTGGG + Intergenic
1010005275 6:70988948-70988970 TTACATAAATATAGGCACCTAGG + Intergenic
1010157847 6:72815452-72815474 AGACATGAGCAAAGGCAGCAAGG + Intronic
1010177187 6:73042700-73042722 TCTCAGAAACAATGGCAGCTAGG - Intronic
1014109651 6:117606196-117606218 TTATATAAACAAAGGGATCTGGG + Intergenic
1014437065 6:121432351-121432373 TAACACAAAAAAAGGAAGCTCGG - Intergenic
1015847101 6:137532124-137532146 AGAAATGAACAAGGGCAGCTTGG + Intergenic
1018562073 6:165110449-165110471 TTACATTAACGAAGTCAGCTAGG - Intergenic
1018562765 6:165119231-165119253 AGGAATAAACAAGGGCAGCTTGG + Intergenic
1018939836 6:168301800-168301822 TGGAATAAACAAAGGCCGCCGGG - Intronic
1020399615 7:7760658-7760680 TGACATGAACAAAGATAGCAAGG + Intronic
1020476125 7:8597214-8597236 TGACAACAACAAAGACAGTTGGG + Intronic
1024516518 7:50263876-50263898 AGACATAATCACAGGCAGTTAGG + Intergenic
1024682823 7:51711552-51711574 AGAGATTGACAAAGGCAGCTAGG + Intergenic
1025262882 7:57432211-57432233 TGAAATAAACAATGGCAGAACGG - Intergenic
1028460008 7:91081717-91081739 TGACATAAATGAAGTCAGCAGGG - Intronic
1028541040 7:91942209-91942231 TCACATAAACAAAGGAAACCAGG + Intronic
1029852342 7:103476167-103476189 TCACATTAAAAATGGCAGCTGGG + Intronic
1031702366 7:124942228-124942250 AGGAATAAACAAAGACAGCTTGG + Intergenic
1032477288 7:132220678-132220700 TGACACAAGCAAAGACTGCTGGG - Intronic
1033921727 7:146401393-146401415 GGAAAAGAACAAAGGCAGCTAGG + Intronic
1034058121 7:148058317-148058339 TGGCATAAACAGATGCTGCTGGG - Intronic
1035175476 7:157046902-157046924 TCACAGAACCACAGGCAGCTGGG + Intergenic
1037866134 8:22443959-22443981 TGACAGAAACAAAAATAGCTGGG - Intronic
1038073209 8:24041120-24041142 TGACATAAAAGAAGGAAGATAGG + Intergenic
1038607206 8:29019697-29019719 TGACCTAAACAAAGTTAGTTGGG - Intronic
1039619787 8:38986011-38986033 TAAAATAAACAAAATCAGCTGGG + Intronic
1039720437 8:40158226-40158248 TGAAAAAAAGAAAGGCAGCTGGG + Intergenic
1041005289 8:53492224-53492246 TGACAGAAAGAAATCCAGCTTGG - Intergenic
1041861032 8:62512562-62512584 TGAGATTAAGAGAGGCAGCTGGG - Intronic
1042067404 8:64893309-64893331 AGACAAAAACAAGAGCAGCTTGG - Intergenic
1043314650 8:78905424-78905446 TAACTTCAACTAAGGCAGCTTGG - Intergenic
1043677183 8:82971957-82971979 AGGAATAAACAAAGACAGCTTGG - Intergenic
1044530584 8:93302378-93302400 TGAAATACATAAAGGCAGATAGG + Intergenic
1044587952 8:93885389-93885411 TAACATGAACAAAGGCAGAGGGG + Intronic
1045052278 8:98338154-98338176 TAAAATAAAGAAATGCAGCTGGG + Intergenic
1045743912 8:105394292-105394314 TTCCCTAAACAAAGGCAGCAGGG - Intronic
1045956950 8:107919321-107919343 AGGAATAAACAAAGACAGCTTGG - Intronic
1046553818 8:115751427-115751449 TGACATAATCTATGTCAGCTAGG - Intronic
1049106214 8:140615088-140615110 TGAAATAAACAAAAGCAGGCTGG + Intronic
1049131767 8:140851130-140851152 TGACAAAAACTCAGTCAGCTAGG - Intronic
1050760245 9:9060104-9060126 TGACATAGAATAAGGGAGCTAGG + Intronic
1050937910 9:11422334-11422356 TAACTTAAATTAAGGCAGCTAGG + Intergenic
1051435720 9:17029070-17029092 TGACATAAACAAAAGCTCTTTGG - Intergenic
1051994097 9:23193168-23193190 TAACAAAAACAAATGCAGATAGG + Intergenic
1054718964 9:68584707-68584729 TGACATAAACAAATACAAATTGG - Intergenic
1055187834 9:73476147-73476169 TGACAAAAAAAAAGGAGGCTGGG - Intergenic
1056317031 9:85400092-85400114 TCTCACAAACAAAGGCAGCAGGG + Intergenic
1056904468 9:90633200-90633222 GGTCAAAAACAAAGGCAGCTTGG + Intronic
1057740973 9:97710979-97711001 TGACATTAACAAAAGCAGTTTGG + Intergenic
1058638138 9:107056694-107056716 TGGCAGAAAAAAAGACAGCTAGG + Intergenic
1058650988 9:107175714-107175736 TTACAGAAACAAAAGCAGCTAGG + Intergenic
1059780554 9:117521873-117521895 AGCCATAAACAGAGGAAGCTGGG - Intergenic
1186621185 X:11241695-11241717 TGAAATAGACAAAGGCAGATAGG + Intronic
1187818246 X:23256439-23256461 TGGGAAAAACAAAGGCAACTAGG + Intergenic
1189953965 X:46259605-46259627 AGGAATAAACACAGGCAGCTTGG + Intergenic
1191879729 X:65833347-65833369 TGAGATAAACATACTCAGCTAGG - Intergenic
1193058160 X:77176593-77176615 AGACATAAACCCAGGCAGCCTGG + Intergenic
1193886795 X:86992951-86992973 TGAAATAAAAATAGGAAGCTAGG - Intergenic
1195333146 X:103822822-103822844 TGACATAAACAGTGGCATTTGGG - Exonic
1196437699 X:115689818-115689840 TTAAAAAAACAAAAGCAGCTGGG - Intergenic
1197073652 X:122330041-122330063 TAACATAAACAAAGACAAATAGG + Intergenic
1197393123 X:125893653-125893675 TGACAAAAAGAAAGGCATCTGGG - Intergenic
1197657914 X:129137568-129137590 TGACTTAAAGAAAGGAGGCTGGG + Intergenic
1199076967 X:143535718-143535740 TGACATCATCAAACCCAGCTTGG - Intergenic
1200382727 X:155856114-155856136 TCACATAAACAAAGTCAGACAGG - Intergenic
1200873777 Y:8130351-8130373 TAACAGAAACAAAAGCAACTAGG - Intergenic
1201052603 Y:9953299-9953321 TAACAGAAACAAAGGCAACTAGG - Intergenic
1201060494 Y:10039841-10039863 ATACATAAACAAATGAAGCTGGG - Intergenic
1201679662 Y:16629959-16629981 AGACAAAAATAAAGGCAGCAAGG + Intergenic
1202187353 Y:22200151-22200173 TAACAGAAACAAAAGCAACTAGG - Intergenic
1202204007 Y:22386245-22386267 TAACAGAAACAAAAGCAACTAGG + Intronic