ID: 1164720718

View in Genome Browser
Species Human (GRCh38)
Location 19:30429938-30429960
Sequence ATGTGGGCCCCAGGAGGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 399
Summary {0: 1, 1: 1, 2: 3, 3: 41, 4: 353}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164720710_1164720718 26 Left 1164720710 19:30429889-30429911 CCAGAATTTGTAGGTACTTGTCA 0: 1
1: 0
2: 1
3: 3
4: 117
Right 1164720718 19:30429938-30429960 ATGTGGGCCCCAGGAGGTCCTGG 0: 1
1: 1
2: 3
3: 41
4: 353
1164720713_1164720718 3 Left 1164720713 19:30429912-30429934 CCTGCAAAGCATTGGGTTTCAGT 0: 1
1: 0
2: 1
3: 25
4: 176
Right 1164720718 19:30429938-30429960 ATGTGGGCCCCAGGAGGTCCTGG 0: 1
1: 1
2: 3
3: 41
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164720718 Original CRISPR ATGTGGGCCCCAGGAGGTCC TGG Intronic
900643601 1:3698725-3698747 ATGTGGGTCCGTGGAGGCCCGGG + Intronic
900929566 1:5727922-5727944 ATGTGGGCCCTTGGAAGTGCAGG - Intergenic
902605930 1:17569385-17569407 CTGAGGGCCCCCGGGGGTCCTGG + Intronic
902647428 1:17810078-17810100 ATTGGGGCCCCAGGAGGTTTTGG - Intronic
902727723 1:18348340-18348362 ATGTGAGACACAGAAGGTCCAGG - Intronic
903072468 1:20733046-20733068 CTGAGGGCCCCTGGAGTTCCAGG + Intergenic
903145424 1:21368924-21368946 ATGTGGGCACCAGGAGGGAAGGG + Intergenic
903383863 1:22914347-22914369 GAGTGGGCACCAGGAGGGCCAGG - Intronic
903683872 1:25116787-25116809 ACGTGGGCTCCTGGAGGGCCTGG - Intergenic
903768099 1:25747536-25747558 ATGTGGGCTCCGGGAGTGCCAGG + Intronic
904078872 1:27859325-27859347 AGGCGGGCTCCAGGAGGTCAGGG - Intergenic
904302942 1:29567222-29567244 ATTAGGGCCCCTGGAAGTCCAGG - Intergenic
904317294 1:29673727-29673749 AGGTGGGCCCCAGGATGCCCAGG - Intergenic
904355236 1:29934398-29934420 ATCTGGGGCCCAGCCGGTCCCGG + Intergenic
904412323 1:30331924-30331946 AGGAGGGGCCCAGGAGGTCGTGG - Intergenic
904617161 1:31756100-31756122 GTGTGGGCAGCAGGAGGGCCTGG + Exonic
906396138 1:45466564-45466586 AGTTGGGTCCCAGGAGGTCAAGG + Intronic
907316846 1:53577684-53577706 TTGTGTGCCCCTGGAGGACCTGG + Intronic
907606669 1:55825103-55825125 ATGTGAGCCACTGAAGGTCCAGG - Intergenic
909804596 1:79858703-79858725 ATCTGGGCTCCAGGAGTTACAGG - Intergenic
911637940 1:100256491-100256513 GCGTGAGCCCCAGGAGGTCAAGG + Intergenic
912270204 1:108200523-108200545 AAGAGGCCCCCAGCAGGTCCAGG + Intronic
913003218 1:114602644-114602666 ACTTGAGCCCCAGGAGGTCAAGG - Intronic
915089598 1:153415402-153415424 TTGTAGGCCGCAAGAGGTCCTGG - Intergenic
916072105 1:161176462-161176484 ATGGGGGCTCCAGGGGGTCCCGG + Exonic
916180775 1:162081628-162081650 ACCTGAGCCCCAGGAGGTCAAGG - Intronic
916717863 1:167460317-167460339 ACCTGAGCCCGAGGAGGTCCAGG + Intronic
916771104 1:167909467-167909489 CTGTGGGCCACATGCGGTCCAGG + Intronic
916869167 1:168893692-168893714 ATGAGAGCTCCAGGAGGTCAGGG + Intergenic
922447488 1:225709737-225709759 ATGTGCGCCCCATGAGGTCATGG + Intergenic
922542117 1:226427464-226427486 ATGTGGGCCCCTGTGGGCCCAGG - Intergenic
922548246 1:226474586-226474608 AAGTGGGCCCTAGGAGGCCATGG - Intergenic
923083246 1:230680421-230680443 ATGGGAGCTCCAGGAGGTGCAGG - Intronic
1063063172 10:2578782-2578804 TTGTGGCCCTCAGGAGGTCACGG - Intergenic
1064589796 10:16877516-16877538 TTGTGGGTCCCAGAGGGTCCGGG - Intronic
1065678386 10:28203195-28203217 TTGTAGGTCCCAGGAGGTCTTGG - Intronic
1066326888 10:34369209-34369231 CTGTGGGCCGCATGTGGTCCAGG + Intronic
1067146947 10:43701132-43701154 ATGTGTGCCCCAGTGGGTCCCGG + Intergenic
1067937598 10:50624587-50624609 AGGTGGGCCCCAGGCGGGGCGGG - Intronic
1069635505 10:69922610-69922632 GTGTGGGCCCCAGGATGTCTGGG - Intronic
1069877787 10:71573810-71573832 CTGTGGGCCCCAGGGGAGCCGGG - Intronic
1070788658 10:79176890-79176912 ATGTGAGCTCCAGGAGGCCAGGG + Intronic
1072584541 10:96769968-96769990 ACCTGAGCCCCAGGAGGTCAAGG - Intergenic
1073075494 10:100823652-100823674 AAGGGGGTTCCAGGAGGTCCAGG + Intronic
1076386549 10:130061051-130061073 ATCTGGGCCCGAGGAAGTCAAGG + Intergenic
1076585614 10:131545446-131545468 TTGTGGGCCCCAGGTATTCCGGG - Intergenic
1077184494 11:1230174-1230196 ATGAGGGTCCCAGGAGGGTCTGG - Intronic
1077225530 11:1437664-1437686 CTGTGGGCCCCATGAGGTGGGGG - Intronic
1078011590 11:7576689-7576711 ATGTGGCCCCCAGGGTGCCCTGG + Intronic
1078627539 11:12971309-12971331 ATTTGAGCCCCAGGAGGTCGAGG - Intergenic
1078734681 11:14009086-14009108 ATGTGAGCTCCATGAGGTCAGGG + Intronic
1080309958 11:30878368-30878390 ACGTGAGCCCCGGGAGGTCAAGG + Intronic
1081330477 11:41794095-41794117 ATTTGGGCCCAATAAGGTCCAGG - Intergenic
1081418221 11:42840986-42841008 AAGTGGGCACCAGGAAGTCTGGG - Intergenic
1081495788 11:43609006-43609028 ATCTGAGCCCAAGGAGGTCGAGG - Intronic
1081537530 11:44006271-44006293 AAGTGGGACCCAGGTGGTTCAGG + Intergenic
1084179055 11:67437564-67437586 ATGGGGGCCACAGGCGGTCGGGG - Intronic
1084785177 11:71437973-71437995 ATGGGGGCCCCAGGAGGGCCGGG - Intronic
1085042599 11:73335267-73335289 ATGTGGGACCCAGAAGATCTGGG + Intronic
1085637078 11:78167238-78167260 ATGTGAGGCCCAGGGGGTCTTGG + Intergenic
1086989883 11:93291322-93291344 ATGTGGGGCCCTGGTGATCCAGG + Intergenic
1088590992 11:111403077-111403099 ATGTGGGCCCCAAGAGTCACAGG + Intronic
1088927868 11:114320584-114320606 CTGTGGGCTCCAGGAAGTCAGGG - Intergenic
1089013848 11:115151009-115151031 TTGTGGGCCCCATGAGGTGTGGG + Intergenic
1089643246 11:119861297-119861319 TCCTGGGCCCCAGGAGGCCCTGG + Intergenic
1090940196 11:131380627-131380649 CTGTGGGCTCCAGAAGGGCCAGG + Intronic
1091536490 12:1414745-1414767 ATGTAGGCCCCATGAGGACAGGG + Intronic
1092180988 12:6446704-6446726 AAGAGGTCCCCAAGAGGTCCAGG + Intronic
1092977587 12:13760224-13760246 ATGTGAGCACCAGGAGGGCAGGG + Intronic
1094433795 12:30398991-30399013 ATGTGGGCCCCAGGGAGGCCTGG - Intergenic
1094840042 12:34339028-34339050 CTGTGGGGCCCAGCAGCTCCGGG - Intergenic
1094841643 12:34344877-34344899 ACGTGGGGCCCAGCAGCTCCAGG + Intergenic
1094853629 12:34393328-34393350 GCGTGGGGCCCAGGAGATCCGGG + Intergenic
1094871636 12:34602197-34602219 GTGTGGGGCCCAGGGGATCCTGG + Intergenic
1096500840 12:52063117-52063139 CTATGGGCCCCTGGAGGCCCTGG + Intergenic
1096595163 12:52690549-52690571 ATGTGGTCCCCAGCAGGGCAGGG + Exonic
1096674096 12:53217261-53217283 ATGGGGGCTCCAGGAGGGGCTGG + Intronic
1097892762 12:64794519-64794541 ACCTGAGCCCCAGGAGGTCAAGG - Intronic
1098182118 12:67858622-67858644 GTGGGAGCCCCAGGAGGTCAAGG + Intergenic
1098614923 12:72510059-72510081 AAGGGGGTCCCATGAGGTCCAGG - Intronic
1099286133 12:80716195-80716217 AGGTGGGGCACAGGAGGGCCAGG - Intergenic
1101309512 12:103563713-103563735 ATGTGCTCTCCAGCAGGTCCTGG - Intergenic
1101332615 12:103769266-103769288 ATTTGTGCCCCAGGAGTTTCAGG - Intergenic
1101737351 12:107473006-107473028 ATGAAGGCCCCAGGTGGCCCAGG + Intronic
1103477899 12:121232220-121232242 ATGCGGGGCCCACGAGGTACAGG - Intronic
1103978104 12:124717029-124717051 CTGTGGGAGCCAGGAGGGCCGGG - Intergenic
1104461265 12:128958128-128958150 ATGTGTGCCCCAGAAGTTACTGG - Intronic
1104645432 12:130494208-130494230 GAGTGGGCTCCAGGAGGGCCAGG - Intronic
1104667212 12:130656132-130656154 GTGTGGGCCCCGGGAGGGCCAGG + Intronic
1106384903 13:29274811-29274833 CTCTGGACCCCAGGAGGTCAAGG - Intronic
1106802571 13:33271407-33271429 CTGTGGGCCCCAGGTGCCCCGGG + Intronic
1107043511 13:35973022-35973044 CTGTGGGCCCCAGAATGTACTGG - Intronic
1107121829 13:36804529-36804551 ATTTGAGCCCAAGGAGGTCAAGG - Intergenic
1108440121 13:50443918-50443940 ATCTGAGCCCAAGGAGGTCAAGG - Intronic
1108526465 13:51289737-51289759 ACCTGAGCCCCAGGAGGTCCAGG + Intergenic
1108736017 13:53283953-53283975 ATGTTTACCCCAGTAGGTCCTGG + Intergenic
1109378124 13:61524408-61524430 ATTTGGGCCCAGTGAGGTCCAGG - Intergenic
1110798773 13:79670678-79670700 ATGTGGGCTCCTGGAGGCCATGG + Intergenic
1113420428 13:110167166-110167188 ATGGGGCCTCCAGGAGTTCCAGG - Exonic
1113463659 13:110498824-110498846 AGGAGGGCCACAGGAGGTCACGG - Intronic
1114482131 14:23042486-23042508 AGGTGGTACCCAGGAGGTGCTGG - Exonic
1115565338 14:34620395-34620417 ACTTGAGCCCCAGGAGGTCGAGG + Intronic
1118339072 14:64879771-64879793 AGGTGAGTCCCAGGAGGGCCCGG - Exonic
1118642130 14:67802652-67802674 AAGTGTGCCCCAGTGGGTCCAGG + Intronic
1119414412 14:74460012-74460034 CTGGGGGTCCCTGGAGGTCCAGG - Intergenic
1121015326 14:90545582-90545604 ATGTGGAGACCAGGAGGACCAGG + Intronic
1121091822 14:91188198-91188220 CTGTGACCCCCAGGAGGTTCTGG + Intronic
1121126298 14:91408930-91408952 ATGTGGCCCACCTGAGGTCCTGG - Intronic
1121562458 14:94885448-94885470 CTGTGGGCCCTTGGAGGGCCGGG - Intergenic
1121684779 14:95827715-95827737 ATATGAGCCCCAGGAGTCCCAGG + Intergenic
1122111598 14:99507196-99507218 ATGTTGGACGCAGCAGGTCCTGG + Exonic
1122145399 14:99685525-99685547 ATGTGAGCCCCGGGAGGACAGGG + Intronic
1122642180 14:103166332-103166354 ATTTGGCCCCCATGAGGTCCAGG + Intergenic
1122695030 14:103548294-103548316 TTGTGGGGCCCAGGAAGCCCTGG + Intergenic
1122901605 14:104784438-104784460 GTGTGGGGCCCAGGAGGTGCAGG - Intronic
1123058232 14:105582403-105582425 GTGTAGGCCCCAGGAGGACTTGG - Intergenic
1123082320 14:105701328-105701350 GTGTAGGCCCCAGGAGGACTTGG - Intergenic
1123886197 15:24730403-24730425 ATGTGGGCCACATGTGGCCCAGG - Intergenic
1124383124 15:29184544-29184566 ATGGAGGCCCCAGGATGTGCAGG - Intronic
1127399682 15:58573446-58573468 GTTTGAGCCCCAGGAGGTCAAGG - Intergenic
1128117535 15:65120235-65120257 ATCTCGGGCCCAGGAGGTCGAGG - Intronic
1129845995 15:78767972-78767994 ATCTGGGTCCCTGGAGGCCCTGG - Intronic
1130371637 15:83289511-83289533 CTGTGGGCCACATGTGGTCCAGG + Intergenic
1130599081 15:85264095-85264117 ATCTGGGTCCCCGGAGGCCCTGG - Intergenic
1131451207 15:92541662-92541684 GAGTGGGTCCCAGGAGGCCCCGG - Intergenic
1131605231 15:93896518-93896540 ATGTGGGCCCCAGGCACTTCAGG + Intergenic
1132341237 15:101079610-101079632 GGGAGGGCCCCAGGAGGACCTGG + Intergenic
1132981026 16:2738781-2738803 CTGAGGTCACCAGGAGGTCCCGG - Intergenic
1133212765 16:4272449-4272471 ATGGGGGCCCCAAGCGGCCCCGG - Intronic
1133457631 16:5956750-5956772 ATCTGAGCCCCAGGAGGTCTAGG - Intergenic
1135506103 16:23037767-23037789 ATGTGAGCCCTAGGAGGGCAAGG + Intergenic
1135599162 16:23767224-23767246 ACTTGAGCCCAAGGAGGTCCAGG + Intergenic
1135648164 16:24181682-24181704 ACCTGAGCCCCAGGAGGTCCAGG + Intronic
1136071095 16:27787740-27787762 GAGTGGACCGCAGGAGGTCCAGG - Exonic
1137044578 16:35643380-35643402 CCTTGGGCTCCAGGAGGTCCTGG + Intergenic
1138348394 16:56333737-56333759 AGCTGGCCCCCAGCAGGTCCTGG + Intronic
1138679956 16:58677262-58677284 ACTTGGGCCCCAGCAGGTGCTGG - Intronic
1139922777 16:70470385-70470407 ATCTGGGCCCCAGGAGCCCCGGG - Exonic
1139954611 16:70687117-70687139 AGCTGAGCCCCAGGAGTTCCTGG - Intergenic
1139962935 16:70728277-70728299 AGCTGGGCCTCAGGTGGTCCTGG + Intronic
1140154538 16:72409626-72409648 GTTTGAGCCCCAGGAGGTCAAGG - Intergenic
1140856338 16:78981176-78981198 ATGTGGTCTCCATGATGTCCTGG + Intronic
1141667177 16:85471791-85471813 ATTGGGGCCCCAGGAGTTCAAGG - Intergenic
1141946873 16:87316771-87316793 ATGTAAACCTCAGGAGGTCCTGG + Intronic
1142177521 16:88651833-88651855 AGGTGTGCCCCATGAGGGCCTGG - Intergenic
1142376331 16:89708836-89708858 ATGTGAGTCCCAGGAGGGCGAGG - Exonic
1143632714 17:8148054-8148076 CTGGGGCCCCCAGGAGGTCCTGG + Exonic
1143733921 17:8897147-8897169 CTGTGGGCCTCAGCAGGGCCTGG + Intronic
1144853763 17:18257246-18257268 TTCTGGGCCCCAGGAGGGCCAGG + Intronic
1145101612 17:20081870-20081892 ACATGGGCCCCAGGGGCTCCTGG - Intronic
1146798341 17:35798739-35798761 ATTTGGGCAGCAGGAGGTTCCGG + Intronic
1148341630 17:46876750-46876772 AAGGGTGCCACAGGAGGTCCTGG - Exonic
1148357789 17:46987338-46987360 ATGTGGGCGCCAGGACGCTCAGG + Intronic
1150143359 17:62748659-62748681 ATTTGAGCCCCAGGAGGTCGAGG + Intronic
1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG + Intronic
1150909752 17:69375672-69375694 ACCTGAGCCACAGGAGGTCCAGG - Intergenic
1150983253 17:70168208-70168230 ACGTGGCCCCTAGGAGGTGCTGG - Intergenic
1151395952 17:73823133-73823155 ATGAGGGCTCCAGGGGGTCAGGG + Intergenic
1151500330 17:74484156-74484178 TCATGGGCCCCAGGAAGTCCAGG + Exonic
1151568958 17:74916489-74916511 ATGGGGGCCCCAGGAGATGCTGG + Exonic
1151791927 17:76311500-76311522 ATGTTTCCCTCAGGAGGTCCAGG + Exonic
1151990253 17:77570119-77570141 CTGTGGGCACCACGAGGGCCTGG + Intergenic
1152195948 17:78918445-78918467 AGGTGGGCCCTGGGAGGTCCTGG + Intronic
1152699842 17:81813395-81813417 ATGAGGCCCACAGCAGGTCCCGG + Intronic
1152722757 17:81930946-81930968 ATGTGGGCCTCAGCAGGTCAAGG - Intergenic
1153033422 18:736087-736109 ACCTGAGCCCCAGGAGGTCAAGG + Intronic
1154493882 18:14941724-14941746 AGGTGGGTACCAGGTGGTCCTGG + Intergenic
1157473996 18:48009797-48009819 ATGTGGGCCCCAGGACCTTTGGG + Intergenic
1157801808 18:50627122-50627144 ATGTGGTCCACAGGAAGTCTGGG - Intronic
1160583539 18:79900779-79900801 GTCTGAGCCCCAGGTGGTCCCGG - Intergenic
1160824169 19:1071642-1071664 ATTGGGGCTCCAGGAGCTCCGGG - Intronic
1160884119 19:1337081-1337103 ACTTGAGCCCCAGGAGGTCGAGG - Intergenic
1161137567 19:2628966-2628988 ATGTGGGCACCAGGCGGTGGGGG + Intronic
1161379238 19:3955937-3955959 ATGGGAGCCCCCGGGGGTCCTGG + Intergenic
1162495522 19:11021265-11021287 ATGTGGGCCCCATGGGGTAGGGG - Intronic
1163018337 19:14470194-14470216 CTGTGGGACCCCGGAGTTCCTGG + Exonic
1163288929 19:16365875-16365897 CAGTGGGCTTCAGGAGGTCCTGG + Intronic
1163290205 19:16374392-16374414 ATTTGAGACCCAGGGGGTCCTGG - Intronic
1163687381 19:18719434-18719456 AGGTGGGCCCCGGCAGGCCCAGG + Intronic
1164720718 19:30429938-30429960 ATGTGGGCCCCAGGAGGTCCTGG + Intronic
1164753573 19:30673267-30673289 ATGTGTGCCCCTGAAGGGCCAGG - Intronic
1165316499 19:35059633-35059655 CTGTGGGACCCAGGCGGCCCCGG + Intronic
1165652869 19:37506632-37506654 ATGTTGGCCACAGGAGGTTTTGG + Intergenic
1165983250 19:39744496-39744518 TTGTTGGCCTCAGTAGGTCCTGG - Intergenic
1166385331 19:42377386-42377408 ATGTGGGGCCCACAAGGCCCTGG - Exonic
1167169243 19:47820184-47820206 GTGTGGGACCCAGGAGCTCAGGG + Intronic
1167498067 19:49830774-49830796 TTGGGGGCGCCAGGGGGTCCTGG - Exonic
1167864288 19:52311721-52311743 ATTTGAGCCCCAGGAGTTCAAGG + Intronic
1168692556 19:58385808-58385830 AGGGCGGCCCCAGGTGGTCCTGG + Intergenic
925100023 2:1236371-1236393 AGGTGCTCCCCAGGAGGACCAGG + Intronic
925862323 2:8191708-8191730 ATGTGGGCCACAGAAGGGCCAGG - Intergenic
926155666 2:10452588-10452610 TTCTGGGCTCCAGGAGGCCCTGG - Intergenic
927199893 2:20571655-20571677 ATGTGGGCCCCAGCAGGTCCAGG - Intronic
928575345 2:32648926-32648948 ACGTGAGCCTGAGGAGGTCCAGG + Intronic
930030810 2:47057002-47057024 ATGTGGGCACCACTGGGTCCTGG + Intronic
930383569 2:50662499-50662521 CTGTAGGCCGCAGGAGGCCCAGG + Intronic
933079933 2:77973060-77973082 AAGTGTGCCCAAGGAGGTCAGGG - Intergenic
936518589 2:113197996-113198018 TTGTGGGCCCCAGGGGGTCCTGG + Intronic
936593247 2:113823549-113823571 AGGTGGGGCCCAGGAGGTCAAGG + Intergenic
937954072 2:127409250-127409272 CTTTGAGCCCCAGGAGGTCCAGG + Intergenic
938387107 2:130874384-130874406 TTGTGGGCCTGAGGAGGGCCTGG - Intronic
938622805 2:133074441-133074463 ATTTGAGCCTCAGGAGGTCGAGG - Intronic
939057870 2:137384853-137384875 ATGAGTGGCCCAGGAGTTCCAGG - Intronic
940281120 2:151990513-151990535 ATGTGAGCTCCAGGAGGAACAGG + Intronic
940992720 2:160114470-160114492 ATGTGGGCCTGGGAAGGTCCAGG + Intronic
941886902 2:170537527-170537549 ATCTGGGCCCAGGGAGGTCGAGG - Intronic
947534073 2:230929940-230929962 AGGAGGGCCTCAGGAGGACCTGG - Intronic
948231250 2:236351202-236351224 AGGTGGGCTCCTGGAGGTCAGGG - Intronic
948425771 2:237885879-237885901 CTGAAGGCCCCAGGAGGTCAGGG - Intronic
948471606 2:238184641-238184663 TTCTGAGCCCCAGGAGGTTCAGG - Intronic
948511004 2:238465288-238465310 ATATGGGGCCCAGGAGACCCCGG - Intergenic
948674873 2:239591335-239591357 GTGTGGGCTCCAGGAGGGCCTGG + Intergenic
948691813 2:239711054-239711076 GTGTGAGCCCCAGGAGCTCCAGG - Intergenic
949044929 2:241868040-241868062 GTGTGGGCCCCTTGTGGTCCTGG - Intergenic
1168750332 20:277439-277461 ACCTGGGCCCCAGGAGGCCCAGG + Intronic
1168940781 20:1709353-1709375 AGCTGGGTCCCAGGAGGACCAGG - Intergenic
1169219252 20:3811999-3812021 GGCTGGGCCCCAGGAGGACCAGG - Intergenic
1169345375 20:4824148-4824170 CTGGGGGCGCCAGGAGGTCCAGG - Intergenic
1169395648 20:5226577-5226599 ATGTGGGCCCCAGGATAGCGTGG - Intergenic
1169539564 20:6584165-6584187 AGGTGGGGGCCAGGAGGTGCAGG - Intergenic
1170473186 20:16688592-16688614 CTGTGGGCGCCAGGAGGAGCTGG + Intergenic
1172221078 20:33275633-33275655 CTGTGAGCCCCAGGAGGGCAGGG + Intronic
1172765824 20:37350189-37350211 AAGTGGCCCCCAGGAGCTCAAGG - Intronic
1174357697 20:50009552-50009574 ATGTCAGCCCCAGGAGGGCAGGG + Intergenic
1175778762 20:61669086-61669108 ACGTGGGTTCCAGGAGGCCCAGG - Intronic
1175821713 20:61913593-61913615 CTGAGGGTCCCAGGAGGGCCTGG + Intronic
1176302427 21:5104918-5104940 ACGGGGGACCCAGGAGGGCCTGG + Intergenic
1176303541 21:5111407-5111429 ATCAGGTCCCCAGGAGGGCCTGG - Intergenic
1178696405 21:34796542-34796564 ATCTGGGGCTTAGGAGGTCCAGG + Intronic
1179171040 21:38972916-38972938 ACGTGAGCCCCAGGAGTTCAGGG + Intergenic
1179854600 21:44157005-44157027 ACGGGGGACCCAGGAGGGCCTGG - Intergenic
1180950849 22:19719895-19719917 GAGTGGCCCCCAGGAGGCCCTGG + Intronic
1182355704 22:29721405-29721427 ATGGGGGCTCCAGGAGGTCTGGG - Intronic
1183301909 22:37062746-37062768 AGGTGGGCCCCAGGACCTCTGGG + Exonic
1183618989 22:38961840-38961862 ATGTGGGCCCAGGGAGGGCAGGG + Intronic
1184195178 22:42922791-42922813 ATGTCAGCCCCAGGAGGGCAGGG - Intronic
1184640754 22:45868752-45868774 CTGTGGGCTCCAGGAGCACCGGG - Intergenic
1184846899 22:47093540-47093562 CTGTGAGCCCTAGGAGTTCCCGG + Intronic
1184955198 22:47881257-47881279 CTGGAGGCCCCAGGAGGCCCCGG - Intergenic
1185062381 22:48613808-48613830 ATGTGGCCCCCTCGAGCTCCTGG + Intronic
1185135150 22:49066216-49066238 CTGTGGGCCCCATGTGGCCCAGG - Intergenic
1185347669 22:50317530-50317552 AGGTGGAGGCCAGGAGGTCCTGG + Intronic
950107485 3:10397496-10397518 AAGTGGGTCCCAGGTGGTCAGGG + Intronic
950493246 3:13318910-13318932 ATGTGGGAGCCAGGAGGGTCGGG - Intronic
952889956 3:38033155-38033177 ATTTGGGCTCCAGGAGGGCAGGG - Intergenic
952916018 3:38243114-38243136 ACTTGAGCCCCAGGAGGTCAAGG - Intronic
953733232 3:45468013-45468035 ACTTGAGCCCCAGGAGGTCGAGG + Intronic
954138199 3:48591967-48591989 ATGTGGGGCCCAGGATGACCGGG + Exonic
954422880 3:50427842-50427864 AGGTTGGCCCCTGGAGGACCAGG - Intronic
954624924 3:52017194-52017216 ATGTGTCCCCCAGGAGTTCTTGG + Intergenic
954908671 3:54085135-54085157 ATGTGGGCAGCAGGAGAGCCTGG - Intergenic
955053833 3:55438561-55438583 ATGTAAGCCCCATGAGGTCAAGG - Intergenic
958016609 3:87945448-87945470 GTTTGGGACCCAGGAGGTACAGG + Intergenic
960091305 3:113641623-113641645 ATGTGGCCCCCAGAATCTCCGGG - Intergenic
960129684 3:114042433-114042455 CTGTGGGGGCCAGGGGGTCCTGG + Intronic
960615150 3:119589560-119589582 GTGTGTGCCCCAGGGGGTCGGGG + Exonic
961183492 3:124895004-124895026 CTGTGGGCCACATGAGGCCCAGG - Intronic
961652106 3:128421787-128421809 CTGTGGGCACCAGGAAGCCCAGG + Intergenic
961773609 3:129268168-129268190 ATGGTGACCTCAGGAGGTCCCGG + Intronic
961783385 3:129334939-129334961 TTGTGGGGCCTGGGAGGTCCAGG - Intergenic
961862203 3:129926049-129926071 ATGTGGGCCCCTGCAGGAGCTGG - Intergenic
962256213 3:133871909-133871931 CTGTGGACCCCAGGAGGATCAGG - Intronic
964706955 3:159629193-159629215 ATTGAGACCCCAGGAGGTCCAGG + Intronic
967037067 3:185655918-185655940 TGGTGAGCCCCAGGAGGTGCTGG + Intronic
967798948 3:193632785-193632807 ACTTGAGCCCCAGGAGGTCAAGG + Intronic
967807277 3:193727227-193727249 ATGTTGGCCCCACGAGGTGAGGG + Intergenic
968264132 3:197349608-197349630 CTGTCGGTCCCTGGAGGTCCAGG + Intergenic
968434250 4:576570-576592 GGGTGGGGCCCAGGGGGTCCGGG - Intergenic
968539016 4:1153223-1153245 CTGTGGACACCAGGAGGTCAGGG + Intergenic
969124688 4:4937981-4938003 CTGTAGGCCCCATGAGGCCCTGG - Intergenic
969306671 4:6329789-6329811 ATCTGGACCCCAGGTGGTCCTGG - Intronic
969350394 4:6594904-6594926 ATGTGGTGGCCAGGACGTCCAGG - Intronic
969484978 4:7467162-7467184 AAGTGGTCCCCTGGATGTCCAGG + Intronic
969494119 4:7516174-7516196 CTGTGAGCTCCAGGAGGACCAGG - Intronic
970303708 4:14708184-14708206 ATCTGGGAAACAGGAGGTCCTGG - Intergenic
970934448 4:21552789-21552811 TTGTGAACCCCAGGAGGTCTGGG - Intronic
972319677 4:37962063-37962085 CTGTGGGCCCCATGAGGGCAGGG + Intronic
973801419 4:54482449-54482471 ATGTGGGCTGCAGGAGGGCAGGG + Intergenic
974084530 4:57245085-57245107 ATGTGAGCACCAGGAGAGCCAGG + Intergenic
976361249 4:84181353-84181375 ATGAGTGCCCCAAGAGGACCCGG - Intergenic
977348982 4:95856376-95856398 ATGTGTGCCCAAGGTGGTCAGGG + Intergenic
978376497 4:108079573-108079595 GTGTGGGGACCAGGAGGACCGGG + Exonic
980158233 4:129132288-129132310 CCCTGGGCCCCAGGAGGTCAAGG - Intergenic
982224848 4:153155920-153155942 AAGTGAACCCCAGCAGGTCCTGG - Intronic
982343937 4:154335215-154335237 AACTGGGCCACAGGATGTCCAGG + Intronic
984158243 4:176220106-176220128 CTGTGGGCCCCATGCGGCCCAGG - Intronic
984803234 4:183733399-183733421 ATGTGGGCTCCGAGAGGTCATGG - Intergenic
984833663 4:183999552-183999574 ATGGGAGCCCCATGTGGTCCAGG + Intronic
985546943 5:514569-514591 CTGAGGGCCCCATGAGGGCCGGG + Intronic
985864808 5:2506487-2506509 ATCTGAGCCCAAGGAGGTCAAGG - Intergenic
992319951 5:75603954-75603976 TTGTAGGCCCCAAGAGATCCTGG + Intergenic
992564758 5:77986254-77986276 ATGTGAGCCCCTTGAGGTCAGGG + Intergenic
995837963 5:116416771-116416793 GTGTGGGCCCAAGGAGATCATGG + Intergenic
996749579 5:126875236-126875258 ACCTGGGCCCCAGGAGGCCAGGG - Intronic
997436154 5:133877260-133877282 TTGTGGGCTCCAGGAAGACCTGG - Intergenic
997762417 5:136462624-136462646 ATGAGGGGCCCAAGAGGTCAAGG - Intergenic
998085528 5:139319183-139319205 ATGTGAGGCCCAGGAGTTCCAGG + Intronic
998224652 5:140317268-140317290 ACCTGAGCCCCAGGAGGTCAAGG + Intergenic
999309802 5:150544791-150544813 TTGTGGGTAGCAGGAGGTCCTGG + Intronic
999322156 5:150622274-150622296 ATTTGAACCCCAGGAGGTCTGGG + Intronic
1000622550 5:163502222-163502244 ACGTGGGGCCCAGGAGTTCGAGG + Intergenic
1001203955 5:169744872-169744894 AGGTGGTTCCCAGGAGGACCTGG + Intronic
1001553465 5:172620691-172620713 CTGTGGGCCCCCCGAGGGCCGGG + Intergenic
1002132470 5:177089994-177090016 GTGTGTGACCTAGGAGGTCCAGG + Intronic
1002302150 5:178263260-178263282 CCCCGGGCCCCAGGAGGTCCAGG + Exonic
1002547596 5:179960563-179960585 GTGTGGGACCCAGGTGGTCTAGG - Intronic
1004607716 6:17209449-17209471 ACTTGAGCCCCAGGAGGTCAAGG - Intergenic
1004871250 6:19906815-19906837 ATGTGGGCCCCAGGCTCTGCTGG + Intergenic
1005122154 6:22401741-22401763 ATGTGGTCCCCAGAGGGACCTGG + Intergenic
1005471886 6:26169312-26169334 CTGAGGGCTCCAGGAGGTCAAGG - Intronic
1006304576 6:33211441-33211463 CTGGGGGCCCCAGGAGGGCTTGG - Exonic
1006550221 6:34816527-34816549 ACTTGAGCCCCAGGAGGTCGAGG + Intronic
1006633900 6:35448758-35448780 ACCTGAGCCCCAGGAGGTCAAGG + Intergenic
1006643128 6:35498490-35498512 ATGGGGGTCCAAGGAGGTCTCGG - Intronic
1006781242 6:36633848-36633870 ACTTGAGCCCCAGGAGGTCAAGG - Intergenic
1007731770 6:43951732-43951754 ATGGGGGCCCCAAGAGATCAAGG - Intergenic
1007973815 6:46079933-46079955 AGGTGAGCCCCAGGAGGACAGGG - Exonic
1014561965 6:122901621-122901643 AGGTGGGCCACAGGAGGGCCTGG + Intergenic
1014979828 6:127932751-127932773 AACTGGGCCCAAGGAGGGCCTGG - Intergenic
1015253916 6:131156554-131156576 ATTTGAGCCCCAGGAGTTCGAGG + Intronic
1017726339 6:157278516-157278538 CTCTGGGCCTCAGGAGGGCCAGG + Intergenic
1017872906 6:158502123-158502145 TAGTGCCCCCCAGGAGGTCCAGG + Exonic
1018163122 6:161067151-161067173 ATGTGTGCCCAAGGTGGTCAGGG + Intronic
1018743691 6:166748569-166748591 ATGGGGGCCCGAGGAGGTGGGGG - Intronic
1019287330 7:230253-230275 CTGGGGGCTCCAGGAGCTCCTGG - Intronic
1019517192 7:1445248-1445270 CTGTGGGGAACAGGAGGTCCTGG + Exonic
1019540119 7:1547566-1547588 GTGTGGGGTCCAGGCGGTCCCGG - Intronic
1020034068 7:4953237-4953259 ATGTGAGCTCCAGGAGGGCAGGG + Intronic
1020079960 7:5282020-5282042 ATGGTGGCCCCGGGAGGGCCGGG - Intronic
1020097514 7:5377084-5377106 CTGGAGGCCCCAGGAGGTTCAGG - Intronic
1020109419 7:5439776-5439798 AAGTGGACCCCAGGAGCCCCAGG - Intronic
1021096645 7:16542483-16542505 ACATGGGCCCAAGGTGGTCCAGG + Intronic
1022304601 7:29135018-29135040 ACTTGGGCCCCAGGAGGTCAAGG + Intronic
1022532209 7:31074061-31074083 CTCTGGGCACCAGTAGGTCCTGG + Intronic
1022537097 7:31105078-31105100 GTGTGGGTATCAGGAGGTCCTGG - Intronic
1023917485 7:44601027-44601049 ATGTGTGCCCCAGGCCTTCCTGG - Intergenic
1024301238 7:47889182-47889204 ATGATGTCCCCAGGAGGTCTGGG - Intronic
1024577969 7:50780365-50780387 CTGTGGACCCTAGGAGGTCTGGG - Intronic
1024991115 7:55235199-55235221 AGGTGCGCCCCAGGAGTTCTGGG + Intronic
1025127557 7:56355934-56355956 CTGTCGGGCCCAGGATGTCCTGG - Intergenic
1026045639 7:66903964-66903986 AGGTGGGCCTCAGGAGGCCGCGG - Intergenic
1028958976 7:96727644-96727666 ATGTAGGCCCCAGGAACTCACGG - Intergenic
1029116647 7:98241124-98241146 GTGTGGCCCACAGGAGGTCGTGG + Exonic
1029420018 7:100467517-100467539 ATCTTGGTCCCAGGAGGTCCTGG - Intronic
1032177196 7:129640424-129640446 AGGAGGGTCCCAGGAGGTCAAGG + Intronic
1032696090 7:134337608-134337630 ATGTGGGGCCCAGGAGGAAATGG + Intergenic
1032831019 7:135625961-135625983 ATGTGGGCCCATGGAGGGCAAGG - Intronic
1033109868 7:138564312-138564334 ATCGGAGCCCCAGGAGGTCAGGG - Intronic
1033824980 7:145178552-145178574 CTGTGGGCCCCTGGAGGTCCAGG + Intergenic
1034267311 7:149787469-149787491 CTGTGGGCTCCAGGACGCCCTGG - Intergenic
1034679677 7:152919154-152919176 ACTTGAGCCCCAGGAGGTCAAGG - Intergenic
1036635026 8:10543270-10543292 ATGGGGCCCCCAGAAGCTCCGGG - Intronic
1037579496 8:20236216-20236238 AGCTGGGCCCCTGGAGGTCAAGG + Intergenic
1039529069 8:38243709-38243731 ATCTGAGCCCAGGGAGGTCCAGG - Intronic
1041778960 8:61556927-61556949 GTGTGGGCCCCCCGAGGGCCTGG - Intronic
1042527814 8:69782494-69782516 ATCTTGGGCCCAGGAGGTCAAGG + Intronic
1043499678 8:80840228-80840250 CTGCGGGCCGCATGAGGTCCAGG + Intronic
1044949091 8:97418235-97418257 ATCTGGGCCCAAGGATGGCCAGG - Intergenic
1046569721 8:115948083-115948105 ATGTAAGCCCCAGAAGGTCAAGG + Intergenic
1047290929 8:123530030-123530052 CTGTGGGCCCTAGGAGGACTAGG + Intronic
1048671850 8:136731175-136731197 ATATGGGCCCAAGGAGATCAGGG - Intergenic
1049569721 8:143363620-143363642 AGGTGGCCCCCAGGAGCTCAGGG - Intergenic
1049729941 8:144171403-144171425 AGGTGGTTCCCAGGAGGGCCCGG - Intronic
1052642357 9:31185131-31185153 ATGTGGGCACCATGAGGACCTGG + Intergenic
1053279132 9:36806049-36806071 ACAGGGGTCCCAGGAGGTCCTGG + Intergenic
1056209447 9:84351574-84351596 ACCTGAGCCCCAGGAGGTCAAGG + Intergenic
1056307467 9:85304015-85304037 AGCTGGGCCCCAGCAGGTCTAGG - Intergenic
1056403604 9:86252570-86252592 ATTGGGGCCCCTGGAAGTCCAGG + Intronic
1057164599 9:92915710-92915732 ATCTGGGCCCAAGGAAGTCAAGG + Intergenic
1057183229 9:93040877-93040899 AGCTGGGCCACAGGAGGTGCAGG + Intergenic
1057407453 9:94785990-94786012 ATGTGGGCCTCATCAGGTCGCGG + Intronic
1057472425 9:95369409-95369431 ATTTGAGCCCCAGGAGACCCCGG - Intergenic
1058936309 9:109772681-109772703 ATGAGAGCCCCAGGTGGTGCTGG + Intronic
1059437127 9:114283724-114283746 ATGGGGGCCCAAGGAGAACCGGG + Exonic
1059448480 9:114355075-114355097 ATGTTGGCCACAGGTGATCCTGG + Intronic
1060558343 9:124521827-124521849 AGGTGGGCCTCAGGAGATCCAGG + Exonic
1060745159 9:126126324-126126346 ATGTGGGCCCCCGAGGGTCCTGG - Intergenic
1061054547 9:128215473-128215495 ATCTGGGCACCAGGAGATCTTGG + Intronic
1061153328 9:128841926-128841948 ATGTGAGCCCCATGAGGTACAGG + Intronic
1061193289 9:129094499-129094521 CTGTGGGGCCCAGCAGGCCCAGG - Intergenic
1061906793 9:133703183-133703205 AGGGGGCCCCCATGAGGTCCAGG + Intronic
1062393172 9:136342141-136342163 ATGTGCCCCCCAGGATGTCCAGG + Intronic
1062415556 9:136447592-136447614 ACGGGGGCTCCAGGAGGCCCTGG + Exonic
1062569345 9:137177890-137177912 CTGGGGGCTCCAGGAGCTCCGGG - Intronic
1186375378 X:8992856-8992878 ATGTAGGGCCCAGGAGCTTCAGG - Intergenic
1188107786 X:26164352-26164374 ATGTCAGCCCTAGGAGGCCCAGG + Intergenic
1188111173 X:26197574-26197596 ATGTCAGCCCTAGGAGGCCCAGG + Intergenic
1188192411 X:27188211-27188233 ATATGTGCCCAAGGTGGTCCGGG - Intergenic
1190877908 X:54472631-54472653 ATGTGGGGCTCATGTGGTCCTGG + Intronic
1191615816 X:63168455-63168477 ATGTGCGCTCCAACAGGTCCTGG - Intergenic
1191620482 X:63210468-63210490 ATGTGCGCTCCAACAGGTCCTGG + Intergenic
1192510478 X:71718045-71718067 CTGTGGGCCCCTGGGGCTCCGGG + Exonic
1192516219 X:71763508-71763530 CTGTGGGCCCCTGGGGCTCCGGG - Exonic
1195230548 X:102842540-102842562 ATGTGGGCACCCTGAGGTGCTGG - Intergenic
1196082748 X:111649965-111649987 AGGTGGGCCCCAGCAGCTCCAGG - Intergenic
1199874995 X:151922013-151922035 ACCTGGGCCCTGGGAGGTCCTGG + Intronic
1200056394 X:153463627-153463649 ATGTGGGCCCCAGAAGGACGTGG - Intronic
1200251386 X:154556096-154556118 ATGTGGGCCCAGGCAGGGCCCGG + Intronic
1200266381 X:154648320-154648342 ATGTGGGCCCAGGCAGGGCCCGG - Intergenic