ID: 1164721036

View in Genome Browser
Species Human (GRCh38)
Location 19:30431740-30431762
Sequence TGCCCCAGGGAGGGGTCCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 533
Summary {0: 1, 1: 0, 2: 5, 3: 48, 4: 479}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164721030_1164721036 -10 Left 1164721030 19:30431727-30431749 CCCTGGCTGCTGCTGCCCCAGGG 0: 1
1: 1
2: 5
3: 101
4: 670
Right 1164721036 19:30431740-30431762 TGCCCCAGGGAGGGGTCCTGCGG 0: 1
1: 0
2: 5
3: 48
4: 479
1164721028_1164721036 3 Left 1164721028 19:30431714-30431736 CCTGATGTCTATTCCCTGGCTGC 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1164721036 19:30431740-30431762 TGCCCCAGGGAGGGGTCCTGCGG 0: 1
1: 0
2: 5
3: 48
4: 479

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164721036 Original CRISPR TGCCCCAGGGAGGGGTCCTG CGG Intronic
900000814 1:13926-13948 GCCCCCAGGCAGGGGCCCTGTGG - Intergenic
900020529 1:184443-184465 GCCCCCAGGCAGGGGCCCTGTGG - Intergenic
900165852 1:1244041-1244063 TGCCCCAGGGGGCGGGCCTGCGG - Exonic
900182986 1:1320593-1320615 TGCCCCAGGGAGGGGCCCCCAGG + Intronic
900241243 1:1618555-1618577 TGCCCAGGGGATGGGTCCTGTGG + Intronic
900280134 1:1861789-1861811 TACCCCAGAGATGTGTCCTGGGG - Intronic
900393884 1:2445236-2445258 AGCCTCAGGGAAGGGGCCTGTGG - Intronic
900422398 1:2561213-2561235 TGCCCCAGGGAGGGGGCGGTGGG + Intronic
900504062 1:3020473-3020495 TGACCCCGGGAGGCGTCCTCTGG + Intergenic
900553346 1:3267829-3267851 TGAACCAGGGAGGCTTCCTGTGG - Intronic
900589493 1:3453442-3453464 GGCCTCAGGGATGGGTCCCGTGG - Intergenic
900690544 1:3977937-3977959 TGGCCCAGGGAGGGGCCAGGAGG + Intergenic
900792184 1:4687987-4688009 GACCCCAGGGAGAGGTTCTGTGG - Intronic
900833040 1:4978724-4978746 TGCCCCAGGCAGGGCCACTGGGG + Intergenic
900842370 1:5064086-5064108 TGCCCCAGACAGGGGTGCAGGGG + Intergenic
900956279 1:5888051-5888073 GGGCCCAGGGAGGGGCCATGGGG + Intronic
901019124 1:6247054-6247076 TGCCCCAGGGTTGGCACCTGGGG - Intergenic
901137354 1:7006644-7006666 TGCCCCAGGGATGATTCATGGGG - Intronic
901241242 1:7694876-7694898 TGAGCCAGGGCGGGGACCTGGGG + Intronic
901322713 1:8349296-8349318 TGTCCCAGAGAGGATTCCTGAGG - Intergenic
901461145 1:9392610-9392632 TGCCTCTGGGAGGGGTCCTTCGG - Intergenic
901686912 1:10948219-10948241 CTCCCCAGGGAGGGGGCCAGGGG - Exonic
901822853 1:11841335-11841357 TGCCGCAGGGAGGGTGCGTGGGG + Exonic
902799072 1:18818357-18818379 TGCCCCAGGGAGTGGGCATTTGG - Intergenic
904048987 1:27626706-27626728 CATCCCAGGGAGGGGTCCCGGGG - Intronic
904266777 1:29322880-29322902 GACTCCATGGAGGGGTCCTGGGG + Intronic
904609305 1:31716210-31716232 TGGCCCAGGCAGGAGTGCTGTGG + Intergenic
904699961 1:32352087-32352109 TGTCCCAGTGAGGGGGCCCGAGG - Intronic
904723503 1:32529329-32529351 TCCCCCAGGGTGGGGTGCAGTGG + Intronic
906648864 1:47496147-47496169 TGCCCCAGGCTGGAGTCCAGTGG + Intergenic
907318464 1:53587781-53587803 TGCCCCCTGGCTGGGTCCTGGGG - Intronic
907674517 1:56506377-56506399 TGCCCCAGTGAGGTGACCTTGGG - Intronic
910509107 1:87983878-87983900 TCCACCAGGGAGGCTTCCTGTGG + Intergenic
912419815 1:109535369-109535391 GGCCCCAGGGAAGGGTTTTGGGG + Intergenic
913256145 1:116955795-116955817 TGGCCCTGGGAAGAGTCCTGTGG + Intronic
913445698 1:118948411-118948433 TGTTCCAGGGACTGGTCCTGTGG + Intronic
913598122 1:120396917-120396939 TCCCACAGAGAGGGATCCTGGGG + Intergenic
914089209 1:144482403-144482425 TCCCACAGAGAGGGATCCTGGGG - Intergenic
914309404 1:146451812-146451834 TCCCACAGAGAGGGATCCTGGGG + Intergenic
914379713 1:147105223-147105245 TGCCCCAGGGATTGGTTTTGTGG + Intergenic
914592707 1:149121325-149121347 TCCCACAGAGAGGGATCCTGGGG - Intergenic
914716388 1:150258104-150258126 TGTCCCAGGAAGGGGTGCAGGGG - Exonic
915933688 1:160077373-160077395 TGCCTCAGGCTGGGTTCCTGAGG - Intergenic
916048074 1:161015549-161015571 TTGCCCAGGGAGGAGTCCAGTGG - Intronic
916091328 1:161309893-161309915 TGCCCCAGCTATGGCTCCTGGGG - Exonic
916434631 1:164766478-164766500 TGCCCTAGGAAGGGCTCCTGAGG + Intronic
916745300 1:167680510-167680532 TGCCCCAGGCAGGAGTGCAGTGG + Intronic
917930049 1:179816781-179816803 TTCCACAGGGTGGGGCCCTGCGG - Intergenic
918115405 1:181491942-181491964 AGCCCCAGGGAGGGGACAGGAGG + Intronic
918152113 1:181806503-181806525 TGCCCTAAGGAGGTGTCTTGTGG - Intronic
919746565 1:201012681-201012703 TGCCCCAGGGTGGAATCCAGTGG + Intronic
920933873 1:210412933-210412955 TGCCCCAAGGGTGGCTCCTGTGG - Intronic
921054177 1:211531749-211531771 TTCCCCAGGGAGGGTTCCGATGG + Intergenic
922461544 1:225817466-225817488 TTCCCCAGGGAGGAGTGATGAGG + Intronic
924450563 1:244175128-244175150 TGCCCAAGGAAGCTGTCCTGTGG + Intergenic
924586316 1:245364126-245364148 TGCCCCAGGCTGGGGGTCTGAGG - Intronic
1062923984 10:1300405-1300427 TGCCCCAAGGAGAGGTGGTGTGG - Intronic
1065024555 10:21527389-21527411 TGACCGAGGGAGGGGCCCCGCGG + Intergenic
1065902934 10:30224362-30224384 AGAGCCAGGGAGGGGACCTGAGG - Intergenic
1067064155 10:43094216-43094238 GCCCCCAGGGAGGAGCCCTGGGG + Intronic
1067079307 10:43204369-43204391 TGCTCCAGGGAGGGCTGCGGTGG - Intronic
1067427624 10:46221628-46221650 GACCCCAAGCAGGGGTCCTGTGG + Intergenic
1067544772 10:47184853-47184875 TGCCCCAGGGACACGACCTGGGG + Intergenic
1067583045 10:47457541-47457563 GACCCCAAGCAGGGGTCCTGTGG + Intergenic
1069712540 10:70499355-70499377 GGGCCCAGGAAGGGGACCTGGGG - Intronic
1070722107 10:78764093-78764115 TGCCCCAGGGAAGGGTTCAGAGG - Intergenic
1071294333 10:84208322-84208344 CACCCCAGGGAGAGATCCTGCGG + Exonic
1072742964 10:97921273-97921295 TGCCCCAGGTAGGGGCTATGGGG + Intronic
1073284613 10:102380184-102380206 AGCCTCAGAGAGGGGTCCAGAGG + Intronic
1073434491 10:103507988-103508010 AGCCCCAGGGTGGGGGTCTGGGG - Intronic
1073596660 10:104807325-104807347 TGGCCCATGGAGAGGTCTTGAGG + Intronic
1075120178 10:119659085-119659107 AGCCCCAGGGAGGGCTCCAAGGG - Intronic
1075182272 10:120222295-120222317 TGCCTGAGGCAGGGGTGCTGGGG - Intergenic
1075686465 10:124368119-124368141 TGCCCCAGGCTGTGGTCCTCGGG - Intergenic
1075724117 10:124603032-124603054 AGTCCCTGGGAGGGGTACTGGGG + Intronic
1075725251 10:124607659-124607681 TGTCCAAGGAGGGGGTCCTGGGG + Intronic
1075848068 10:125562911-125562933 TGCCCCAGCTAGGGGAGCTGTGG + Intergenic
1076191035 10:128483604-128483626 TGCCCCACGGCAGGGTGCTGAGG + Intergenic
1076555718 10:131320282-131320304 TGCCCCAGGGACTGGTCCCAAGG - Intergenic
1076626953 10:131827079-131827101 TGTCGCAGGGTGGGGGCCTGGGG - Intergenic
1076698086 10:132256725-132256747 TGCCCCTGTGGGTGGTCCTGGGG - Intronic
1076931428 10:133534379-133534401 TGCCGCTGGGAGGAGCCCTGTGG - Intronic
1076931957 10:133537332-133537354 TGCCAAAGGGAAGGGTCTTGGGG - Intronic
1077050350 11:563600-563622 TGCCCCAGAGTGGTGTCCTCTGG + Exonic
1077060151 11:614328-614350 TGGGGCAGGGAGGGGGCCTGGGG + Exonic
1077111513 11:864163-864185 TGCCCCAGGGATGGGGGCAGGGG + Intronic
1077308894 11:1879864-1879886 TGGCCCAGGCGAGGGTCCTGGGG - Intronic
1077317184 11:1924840-1924862 GGCCCCTGAGAGGGGTTCTGAGG - Intronic
1077365285 11:2159070-2159092 TGCCCAAGGCATGGGTTCTGAGG + Intronic
1077395665 11:2319917-2319939 TCCCACAGGGGTGGGTCCTGTGG + Intergenic
1077409299 11:2396014-2396036 CGCCCCTGGGTGGGGTCCTAGGG + Intronic
1077484344 11:2831985-2832007 TGCTCCAGGGGGGTGGCCTGAGG + Intronic
1077488013 11:2847983-2848005 GGCCCCGATGAGGGGTCCTGAGG + Exonic
1077544767 11:3164620-3164642 TGCCCCAGAGATGGGGGCTGTGG + Intronic
1078061442 11:8047754-8047776 AGCCCCAGGGAGGGTCCTTGGGG + Intronic
1079000753 11:16753403-16753425 TGCCCCAGGCTGGGGTGCAGTGG + Intronic
1079318646 11:19431369-19431391 TGCCGCAGGAGGAGGTCCTGGGG + Intronic
1080873717 11:36258734-36258756 TGCCACAGGGTGGGGCTCTGAGG + Intergenic
1081667556 11:44925418-44925440 GGCTCCAGGGAGGGCTTCTGGGG + Intronic
1081882944 11:46469702-46469724 TGCCCCAGGGTGGAGTGCAGTGG + Intronic
1081984357 11:47290746-47290768 TGCCACAGGAAAGGGTCCTAAGG + Exonic
1082794817 11:57371246-57371268 TGCCCCAGGGCAGGGCTCTGGGG + Intergenic
1083299160 11:61731227-61731249 TTCCCCAGGGTGGGAGCCTGCGG - Intronic
1083364532 11:62133494-62133516 CGCCCCAAGGTGGAGTCCTGAGG - Intronic
1083630426 11:64092370-64092392 TGGGCCTGGCAGGGGTCCTGGGG + Intronic
1083782863 11:64926972-64926994 TTCTCCACGCAGGGGTCCTGCGG - Intronic
1083989246 11:66236625-66236647 TGACCTAGGGAGGGGTCCGGGGG + Intronic
1084110879 11:67013575-67013597 TGGCCCAGGGAGGGGGCTTGTGG - Intronic
1084177596 11:67431526-67431548 GGGCCCAGGCAGGGGTGCTGGGG + Intronic
1084207690 11:67605461-67605483 TGACCAAGAGAGGGGGCCTGCGG + Intronic
1084389342 11:68865039-68865061 TGCCCCAGGGTGGAGTGCAGTGG - Intergenic
1084422061 11:69065437-69065459 TGCCCCACGAAGGGGACCTAGGG + Intronic
1084438350 11:69157005-69157027 TCCCCCAGGAAGGGGACCGGTGG - Intergenic
1084438633 11:69158099-69158121 TGCCCCAGGGGTGGGACATGGGG - Intergenic
1084525904 11:69697878-69697900 TTCCCCAGGGAAGAGTGCTGAGG + Intergenic
1084526979 11:69703871-69703893 AGCCCCAGGGAGGTGCCATGCGG - Exonic
1084531655 11:69731175-69731197 TGACCCAGGGAAGGGGCCTCCGG - Intergenic
1085574267 11:77588810-77588832 TGGCCCAGGCAGGGGTGCAGTGG + Intronic
1087408989 11:97766486-97766508 TCCCCCAGGCTGGAGTCCTGTGG - Intergenic
1088421933 11:109657918-109657940 TGCCCCAGGCTGGGGTGCAGTGG - Intergenic
1088578922 11:111298507-111298529 AGCGCCTGGGAGGGCTCCTGGGG - Intronic
1089129342 11:116199744-116199766 TACCCCAGGCAGGGCCCCTGGGG - Intergenic
1089215147 11:116830505-116830527 CTCCCCAGGGAGGGGTCCAGAGG + Intronic
1089468747 11:118704087-118704109 AGACCCAGGGATGGGCCCTGTGG - Intergenic
1089692081 11:120193213-120193235 TGCTCCAGGGCTGGGGCCTGAGG + Intergenic
1090183448 11:124720274-124720296 TGACCCAGGGAGTTGTCCAGGGG + Intergenic
1090837103 11:130461717-130461739 TGCCCTAAGAAGGGGTCCTAAGG - Intronic
1090925154 11:131243073-131243095 TACCCCAGGAAGGGCTCTTGAGG + Intergenic
1091194281 11:133718312-133718334 GGCCCTAGGGAGGGCTTCTGAGG - Intergenic
1091767837 12:3133468-3133490 TTCCCCTGGGAGGGTCCCTGGGG - Intronic
1094090494 12:26644234-26644256 TGCCCCAGGTATGGCTCCAGTGG + Intronic
1094832563 12:34307052-34307074 AGCCCCAGTGTGGGGACCTGGGG + Intergenic
1095799033 12:46252332-46252354 TGTCACAGGGTGGGGGCCTGGGG + Intronic
1096747813 12:53739783-53739805 TCCCCCAGGGAGCCGTCCCGCGG - Intergenic
1097146419 12:56942424-56942446 TGTCCCAGGGAAGGGACCTGGGG + Intergenic
1097147310 12:56950716-56950738 TGCCCCAGGGAAGGGATCTGAGG + Intergenic
1097151181 12:56981041-56981063 TGCCCCAGGGAAGGGACCTGGGG + Intergenic
1097836100 12:64274118-64274140 CACCCCAGGAAGGGGCCCTGAGG + Intronic
1099953433 12:89328885-89328907 TGCCCCAGGGAGTGGGTGTGGGG - Intergenic
1100565535 12:95790586-95790608 TGCCCCGCGGAGCGGCCCTGCGG + Exonic
1100611556 12:96194972-96194994 AGCCCCAGGGAGGGGAGCCGCGG - Intronic
1101926040 12:108972129-108972151 TGCCCCAGCCAGGGGTAATGAGG + Intronic
1101935330 12:109052526-109052548 TCCCCCTGGGAGCTGTCCTGCGG + Intronic
1102164380 12:110794935-110794957 TGCCCCCGGGAGGCATCCTGTGG + Intergenic
1105016263 12:132787899-132787921 GGGTCCAGGGAAGGGTCCTGGGG - Intronic
1106511720 13:30418905-30418927 AGGCCCAGGGAGGGGGACTGGGG - Intergenic
1106541140 13:30691042-30691064 TGGCCCAGGGACAGGACCTGCGG - Intergenic
1108379917 13:49845867-49845889 GGGCCCAGGGAGGGCTCCAGAGG + Intergenic
1108430036 13:50344155-50344177 TCCCCCAGGGTGGAGTGCTGCGG + Intronic
1111676532 13:91395697-91395719 TCCCCCAGGCTGGAGTCCTGTGG + Intergenic
1112388512 13:98961727-98961749 GGCCCCAGGGACACGTCCTGTGG + Intronic
1112417677 13:99217324-99217346 TCTCCCAGGGAGAGGTCCCGTGG + Intronic
1113795628 13:113056077-113056099 TCTCCATGGGAGGGGTCCTGTGG + Intronic
1113893459 13:113748742-113748764 TGGCTGAGGGAGGCGTCCTGAGG - Intergenic
1113974097 13:114213419-114213441 TTCCACAGGGATGGGTTCTGTGG - Intergenic
1113974144 13:114213579-114213601 TTCCACAGGGATGGGTTCTGTGG - Intergenic
1117534984 14:56694946-56694968 TCCCCCAGGGAGGCTTTCTGAGG - Intronic
1118317968 14:64737249-64737271 TTCCCCAGGGAGCTGTCCAGAGG + Intronic
1118966691 14:70593876-70593898 TGCCCCAGTGCTGGGTCCTAAGG + Intronic
1119555695 14:75550748-75550770 GACCCAAGGGATGGGTCCTGTGG - Intergenic
1120870944 14:89337070-89337092 TGCCCAAGAGAGGGGTCCTTAGG + Intronic
1120993505 14:90397956-90397978 TGCGCCCGGGCGGGGCCCTGCGG + Intronic
1122505032 14:102226831-102226853 TCCTCCATGGAGGGGGCCTGTGG + Intronic
1122779640 14:104138345-104138367 TGCCCCGGGGAGGGGCGCTGGGG - Intergenic
1122788479 14:104174627-104174649 AGCCCCAGAGAGGGGTCCCTAGG - Intronic
1122853082 14:104547200-104547222 TGTCACAGAGAGGGGTGCTGCGG - Intronic
1122857649 14:104567513-104567535 TGCAGCAGGGAGGGGCCCTCCGG + Intronic
1122888759 14:104723277-104723299 TGGCCAAGAGAAGGGTCCTGGGG - Intergenic
1122905327 14:104799057-104799079 TTCCTCAGGAAGGGGTCCTTAGG + Intergenic
1122993675 14:105250915-105250937 TGCCACTGGGAGGGGATCTGGGG - Exonic
1123000383 14:105290815-105290837 GGCCCCAGGGAGGGTGACTGTGG - Intronic
1123450486 15:20356797-20356819 GGCCCGGAGGAGGGGTCCTGAGG - Intergenic
1123991861 15:25689403-25689425 TGCCCCAGGCAGGGGGCAAGAGG - Intronic
1124414831 15:29466466-29466488 GGCCCCAGGGGAGGGTCCAGGGG + Intronic
1125029304 15:35060379-35060401 TGCCCCAGGCAGGAGTGCAGTGG - Intergenic
1125887194 15:43237918-43237940 TGCCCCAGAAATGGATCCTGAGG - Intronic
1126859852 15:52872979-52873001 TGCCCCAGGCTGAGCTCCTGTGG + Intergenic
1126875231 15:53034064-53034086 AGTCCCAGGGAGGAGTCCTAAGG - Intergenic
1127289019 15:57554032-57554054 AGTCCCTGGGAGGGGTCCAGAGG - Intergenic
1127720527 15:61694608-61694630 TGCCCCAGGGATGAATCATGTGG + Intergenic
1127823716 15:62684216-62684238 TTCCCCAGTGAGGGCTTCTGGGG - Intronic
1128052174 15:64674266-64674288 TGTCCCAGGAAGGGGGCCAGTGG - Exonic
1128548557 15:68583438-68583460 TGCCCTGGCAAGGGGTCCTGGGG + Intronic
1129111302 15:73338912-73338934 TGACACAAGGAGAGGTCCTGGGG - Intronic
1129261673 15:74372030-74372052 TGGCCTTGGGAGGGGTCATGTGG + Intergenic
1129274381 15:74435377-74435399 TGCCCCAGAGAGGGAGGCTGTGG + Intergenic
1129595208 15:76958418-76958440 GGCACCAGGGAGGGGTTTTGTGG + Intergenic
1130926205 15:88387826-88387848 TATCTCAGGGAGGGGGCCTGTGG - Intergenic
1131093636 15:89642169-89642191 GGCCTCAGGGTGGGGTGCTGGGG - Intronic
1131225382 15:90620649-90620671 AGCCCCAAGGAGGCTTCCTGGGG + Intronic
1132285274 15:100658031-100658053 CGTCCCAGTGAGGGGCCCTGAGG - Intergenic
1132452696 15:101977019-101977041 GCCCCCAGGCAGGGGCCCTGTGG + Intergenic
1132454203 16:13607-13629 GCCCCCAGGCAGGGGCCCTGTGG - Intergenic
1132466451 16:79551-79573 TGCCCCAGGGAGCGCTGCTTGGG + Exonic
1132575525 16:662087-662109 GATCCCAGGTAGGGGTCCTGAGG - Intronic
1132657079 16:1045877-1045899 TGCTGCAGGGAGGGGTCCGGGGG + Intergenic
1132704518 16:1237332-1237354 GTCCCCTGGGAGGGGGCCTGGGG + Intergenic
1132706996 16:1249093-1249115 GTCCCCCGGGAGGGGGCCTGGGG - Intergenic
1132783731 16:1642741-1642763 TGCCCCAAGTATGGATCCTGCGG - Intronic
1132818199 16:1845836-1845858 TGCCGGAGGCTGGGGTCCTGGGG - Intronic
1132820789 16:1869162-1869184 TGCCCCAGGGTGGAGTGCAGTGG + Intronic
1133277271 16:4646550-4646572 AGCCCCATGGAGAGGTCCCGAGG - Intronic
1133871169 16:9687704-9687726 TTTCCCAAGGAGGGTTCCTGGGG - Intergenic
1135221908 16:20621332-20621354 TGGCCCAGGGTAGGGTCCTGGGG + Intronic
1135935348 16:26775110-26775132 TGCCCTAGGGTTGGCTCCTGGGG + Intergenic
1136381658 16:29898893-29898915 GGCCCCAGGAAGGCGTCCAGCGG - Intronic
1136577985 16:31135475-31135497 TGGCCCAGAAGGGGGTCCTGGGG - Exonic
1136991187 16:35152273-35152295 TCCCACAGGGAGGGGTACAGGGG - Intergenic
1137589582 16:49685461-49685483 TGCACCAGGGCAGGGGCCTGGGG - Intronic
1137720449 16:50624728-50624750 TGTCCCAGGGAGGGGTGAGGAGG + Intronic
1137850618 16:51738419-51738441 TGACCCAGTGAGTGGTCCCGAGG + Intergenic
1139405225 16:66712640-66712662 TGGCCCAGGGCAGGGTCATGTGG - Intergenic
1141148421 16:81547853-81547875 TGCCCCAGGGCCAGGTGCTGTGG + Intronic
1141660838 16:85440712-85440734 TGCCCCCGTGATGGTTCCTGGGG - Intergenic
1141663498 16:85453976-85453998 TGCCCCAGGAAGGAGACTTGGGG + Intergenic
1141664236 16:85457663-85457685 TGCCCCAGGAAGGAGACTTGGGG + Intergenic
1141689713 16:85589204-85589226 TGCCCCAGGCAGGAGGTCTGGGG - Intergenic
1141729066 16:85809772-85809794 TGCCCGAGGGTGGGCTCCTGGGG + Intergenic
1142027090 16:87820151-87820173 GTCCCCTGGGTGGGGTCCTGGGG + Intergenic
1142173765 16:88635641-88635663 TGCCACAGAGAGGGGCCCAGGGG - Intergenic
1142205039 16:88778867-88778889 TGGCCCAGGGAAGGCACCTGGGG + Intronic
1142285746 16:89170863-89170885 TGCTCCAGGCAGGGGGCCTCGGG + Intergenic
1142293115 16:89201699-89201721 TGGACCAGGGCGGGCTCCTGGGG + Intergenic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1142353299 16:89589596-89589618 AGACCACGGGAGGGGTCCTGTGG - Intronic
1142709285 17:1714826-1714848 TGGCCCAGGGAGGGGGCTGGGGG + Intergenic
1143165357 17:4894730-4894752 GGCCCAAGGGAGAGGTCCTGTGG - Intronic
1145943819 17:28758706-28758728 TGCGCCAGGCAGAGTTCCTGCGG + Exonic
1146261627 17:31425860-31425882 GGCCCCAGGCAGGGGAGCTGGGG - Intronic
1146464295 17:33074099-33074121 TGCCTCAGTTAGGGCTCCTGGGG - Intronic
1146632975 17:34483974-34483996 TCCCCCCGGCAGGGCTCCTGGGG + Intergenic
1147332190 17:39705659-39705681 TGGCCCAGGCAGGGAACCTGGGG + Intronic
1147353105 17:39867862-39867884 TCCCCTAGGAAGGGGACCTGAGG - Intergenic
1147541458 17:41363732-41363754 TGCCTCGGGGTGGGGTCCGGTGG + Exonic
1148052637 17:44776667-44776689 TGCCCCAGGGAGGAATGCTGGGG - Intronic
1148075691 17:44934144-44934166 TGACCCAGGATGGGGCCCTGTGG + Intronic
1148238146 17:45983078-45983100 CACTCCAGGGAGGGCTCCTGAGG - Intronic
1148758337 17:49986257-49986279 CCCTCCAGGGAGGGGTCCTTAGG + Intergenic
1148865156 17:50624445-50624467 TGCCCCAGGTTGGGGCGCTGTGG - Exonic
1149018366 17:51934720-51934742 TGCTCCAGGGATAGTTCCTGGGG + Intronic
1149523909 17:57339493-57339515 TGCCACAGGGAGGGGGCCCGAGG - Intronic
1150011223 17:61506034-61506056 GGCCTCAGGGAGGGGTGATGTGG - Intergenic
1151106350 17:71620712-71620734 TTCCCCAGGGAGGGGTGGAGAGG + Intergenic
1151473355 17:74331394-74331416 GGCCACCGTGAGGGGTCCTGGGG + Intronic
1151487483 17:74410356-74410378 AGCCACAGGGAGAGGCCCTGAGG + Intergenic
1152077911 17:78169952-78169974 TGAACCAGGGAGGGTTCCAGGGG + Intronic
1152336921 17:79703850-79703872 TGCCCGAGGGAGGGGCTCAGAGG + Intergenic
1152588126 17:81198135-81198157 TGCCCCTGTGATGGGTCCTGGGG + Exonic
1153285543 18:3451785-3451807 TCCCGCGGGGAGGGGTCCTTAGG - Exonic
1154165620 18:12012235-12012257 GAGCCCAGGGAGGGGCCCTGGGG - Intronic
1154412141 18:14147213-14147235 AGCACCGGGGAGGAGTCCTGAGG - Intergenic
1155151254 18:23124793-23124815 TGCCCTTGGCAGGGGGCCTGAGG - Intergenic
1156819620 18:41356685-41356707 TTCCACAGGGAGTGGCCCTGGGG + Intergenic
1157549237 18:48569819-48569841 AGCCCCAGGCAGGGGGCCAGGGG - Intronic
1157593581 18:48850673-48850695 GGCCCCAGGGAGGAAGCCTGTGG + Intronic
1159392214 18:67807681-67807703 GGCCCAAGGAAGGAGTCCTGGGG - Intergenic
1159480853 18:68989604-68989626 AGCCTCAGGCAGGGGGCCTGCGG + Intronic
1159879601 18:73845950-73845972 TGCCCCATAGAGAGCTCCTGTGG + Intergenic
1160720975 19:596786-596808 GACCCCAGAGAGGGGACCTGGGG - Intronic
1160906538 19:1454054-1454076 TGCAGCTGGGAGGGGTCATGTGG + Intronic
1161029748 19:2052090-2052112 TGCCCCAGGCCCGGGGCCTGGGG - Intergenic
1161081467 19:2312635-2312657 TGTCCCAGGGAGGGAGGCTGCGG - Intronic
1161572795 19:5039705-5039727 TGCCCCTGGGGGGTGTCCCGAGG + Intronic
1161965022 19:7543001-7543023 TTCAGGAGGGAGGGGTCCTGGGG - Exonic
1162030057 19:7913422-7913444 GGGCCAAGGGAGGGGTCCGGAGG + Exonic
1162034687 19:7932591-7932613 GCCGCCTGGGAGGGGTCCTGGGG + Intronic
1162067234 19:8133190-8133212 CACTCCAGGGAGGGATCCTGGGG - Intronic
1162067407 19:8134502-8134524 CACCCCAGGGAGGGGCCCTGGGG - Intronic
1162081450 19:8220251-8220273 AGCCTCGGGGAGGGGTGCTGAGG - Intronic
1162155835 19:8677515-8677537 TGCCCCAGGGAACAGTCCTGAGG + Intergenic
1162954961 19:14092387-14092409 TTCCCCGGGGAGGGGCCCAGGGG + Exonic
1163019749 19:14475698-14475720 AGCCCCAGGGAGGGGGGCAGTGG - Intergenic
1163202173 19:15777352-15777374 TGCCCTAGGGATATGTCCTGAGG - Intergenic
1163604182 19:18265148-18265170 TGGCCCAGGGTGGGGCGCTGAGG + Exonic
1163851812 19:19668711-19668733 AGCCCCAGGGGCGGGACCTGGGG + Intergenic
1164721036 19:30431740-30431762 TGCCCCAGGGAGGGGTCCTGCGG + Intronic
1165071891 19:33260679-33260701 TGCACCAGGGAGGGGCCGGGTGG - Intergenic
1165937005 19:39395480-39395502 TCCACCAGGGCGGGGTCGTGAGG + Intronic
1166966703 19:46533445-46533467 AGCTCTGGGGAGGGGTCCTGGGG + Intronic
1166969492 19:46555275-46555297 TTCCCCAGGCTGGGGTGCTGTGG - Intronic
1166996723 19:46723002-46723024 TGCCCCAGGGTGGGGGACAGTGG + Intronic
1167047475 19:47058880-47058902 TGACTCAGGGTGGGGCCCTGGGG - Intergenic
1167424513 19:49423211-49423233 TGCCCCCGGTCGGGGTCCTCAGG - Exonic
1167605961 19:50481357-50481379 TGGCCCAGGGAGGGGCATTGGGG + Intronic
925034348 2:674304-674326 TGCCCCACGCAGAGGCCCTGAGG - Intronic
925085444 2:1104150-1104172 TGACCCAGAGAAGGGTCTTGGGG - Intronic
925117147 2:1389200-1389222 TGCCACAGGGAAGGGTGCTGAGG + Intronic
925356637 2:3246691-3246713 GGCTACAGGGAGGAGTCCTGTGG - Intronic
925485838 2:4329635-4329657 TGCCCCAGGGCAAGTTCCTGAGG - Intergenic
928178246 2:29049733-29049755 TTCCCCAGGAAAGGATCCTGGGG - Intronic
929563479 2:42970027-42970049 TGCCCAAGGGTGTGATCCTGTGG + Intergenic
929896830 2:45967962-45967984 TTCCCCAGGCAGGTGTGCTGTGG - Intronic
929996095 2:46827063-46827085 TGCTCCAGGGAAGCTTCCTGAGG + Intronic
930009949 2:46929121-46929143 TGCCCCAGGCTGGGGTGCAGTGG - Intronic
932203868 2:69859692-69859714 TGGCCCAGGCTGGGGTCCGGTGG - Intronic
932310321 2:70734445-70734467 TGCCCCAGGGAAGCCTCTTGGGG + Intronic
932318465 2:70802139-70802161 AACCCCAGGAAGGAGTCCTGTGG - Intergenic
932421990 2:71606609-71606631 TCTCCCAGGCAGGAGTCCTGAGG - Intronic
932467831 2:71934909-71934931 TGCCCCCAGCAGGAGTCCTGTGG + Intergenic
933701001 2:85255519-85255541 AGCCCCAGGGCAGGGGCCTGAGG + Intronic
934660818 2:96142830-96142852 TGCCTGAGGGTGTGGTCCTGTGG - Intergenic
936151260 2:110023523-110023545 TGTCCCAGTCAGGGGTCCTGGGG + Intergenic
936193415 2:110347846-110347868 TGTCCCAGTCAGGGGTCCTGGGG - Intergenic
936516730 2:113185788-113185810 AGCCCCAGGGAGGGAGCCTCTGG + Intronic
936568909 2:113599493-113599515 GCCCCCAGGCAGGGGCCCTGTGG + Intergenic
936885117 2:117300598-117300620 TCCCCCAGGGGTGGGTCCAGAGG - Intergenic
937067108 2:119025848-119025870 TGCCACTGTGAGGGGTCCAGAGG + Intergenic
937336458 2:121065390-121065412 TGGCCCAGGGACAGGTCCAGTGG + Intergenic
938091387 2:128437062-128437084 TGCACCAGGGAGGGGTGTGGAGG + Intergenic
938383758 2:130850642-130850664 TGCCCCAAGCAGGGGTGCAGTGG + Intronic
939381256 2:141440111-141440133 TGCCACAGGGAGGGGACTCGGGG - Intronic
939507763 2:143070478-143070500 TTCCCCAGGCAGGGGTGCAGTGG - Intergenic
939716340 2:145588857-145588879 TGTCCCAGGCAAAGGTCCTGAGG - Intergenic
942450110 2:176103978-176104000 TCCCCCAGGGAGGCGGGCTGAGG + Intergenic
946185674 2:217979093-217979115 TGCCCCTGGCAGGGGTCCAGTGG - Intronic
946693996 2:222333711-222333733 GGCCCCTGGGAGGGGTGCTTAGG - Intergenic
948287328 2:236795910-236795932 TGGGCCAGGGATGGGCCCTGGGG + Intergenic
948465615 2:238150351-238150373 TGCCCCTGGGAGGGGTTGTGGGG - Intronic
948632329 2:239310105-239310127 TCCCCCAGCAGGGGGTCCTGGGG - Intronic
948654486 2:239468415-239468437 GGTCCCTGGGAAGGGTCCTGAGG + Intergenic
948797812 2:240413577-240413599 AACCCCAGGGAGGGGTTCTCAGG + Intergenic
948921434 2:241067758-241067780 TTCCACAGGGCGGGGTCCTAGGG - Exonic
948923990 2:241082185-241082207 TGCCCAAGGGAGAGGGCCCGGGG - Intronic
949006622 2:241653041-241653063 GGCCCCAGGGAGTGGCCGTGAGG + Intronic
949044769 2:241867341-241867363 TGCCCCAGGCCTGGGTCCTAGGG + Intergenic
1169203933 20:3729826-3729848 ATCCCCATGGAGGGGACCTGGGG + Intergenic
1170736965 20:19021113-19021135 GGCCACAGGGAGGTGACCTGGGG + Intergenic
1171391183 20:24802666-24802688 TGCCCCTGGGACATGTCCTGGGG - Intergenic
1172097356 20:32466954-32466976 TGACCCAGGGATGGGCCCAGGGG + Intronic
1173428265 20:42961664-42961686 CTCTCCAGGGAGGGGTACTGTGG + Intronic
1173723735 20:45282238-45282260 TGCCCCTGGGAGGTGTGCAGAGG - Intergenic
1175319206 20:58073469-58073491 TGCACCTGGGCGGGGGCCTGGGG - Intergenic
1175810984 20:61857128-61857150 TGCCCCGGGGAGGGGTATGGGGG - Intronic
1175824175 20:61927711-61927733 GGAGCCAGGGAGGGGTTCTGCGG - Intronic
1175839764 20:62019574-62019596 TTCCCCAGGGAGGCGTCTCGTGG - Intronic
1175970730 20:62685335-62685357 TGCCCAAGGGTGGGTTCGTGGGG + Intronic
1176132162 20:63500727-63500749 TGGCCCAGGCCGGGGTCCCGGGG + Intergenic
1176142187 20:63549668-63549690 AGCCCCAGGGAGGCCTCCTCAGG + Intronic
1176285309 21:5016229-5016251 TGCCCTAGGGAGGGTGCCTGAGG + Intergenic
1176722269 21:10402310-10402332 TGCCCCAGCGGAGGGCCCTGGGG + Intergenic
1178513964 21:33230419-33230441 AGGGCCCGGGAGGGGTCCTGGGG - Intronic
1178535037 21:33403798-33403820 TGCCCCAGGTGGGGGTCTTGCGG + Intronic
1179018704 21:37617877-37617899 TGACCCAGGGAGGTGCTCTGTGG + Exonic
1179484593 21:41701636-41701658 TACTCCAGGGAAGGTTCCTGGGG - Intergenic
1179573588 21:42292475-42292497 TGCCCTAGGCAGGGGTCCTGGGG - Intronic
1179632732 21:42688699-42688721 GACGCCAGAGAGGGGTCCTGAGG - Intronic
1179675959 21:42982184-42982206 TGGCCCAGGGAGTGGTGCTTGGG + Intronic
1179871872 21:44247246-44247268 TGCCCTAGGGAGGGTGCCTGAGG - Intronic
1180084600 21:45502176-45502198 AACCCCAGGGACGGCTCCTGTGG + Intronic
1180095020 21:45552436-45552458 GGCCCCAGGGAGAGCCCCTGGGG + Intergenic
1180979404 22:19871676-19871698 GGCCCATGGGAGGGGTCTTGTGG + Intergenic
1181040802 22:20191825-20191847 AGCACCAGGGAGGGGTCCAGGGG - Intergenic
1181493746 22:23276466-23276488 TCCACCAGGGCGAGGTCCTGGGG - Intronic
1181637177 22:24179954-24179976 GGCTCCAGGGAGGGGTGCTGGGG - Intergenic
1181646553 22:24234353-24234375 AGTCCCAGGGTGGGCTCCTGAGG - Intronic
1181664697 22:24385021-24385043 TGCCCCAGGGTGGAGTTCAGTGG - Intronic
1182045618 22:27271782-27271804 TGCTCCAAGCAGAGGTCCTGTGG - Intergenic
1182124171 22:27804327-27804349 TGCTCCAGGGAGGGGGGGTGTGG + Intergenic
1182124280 22:27804999-27805021 TGCCCCCGGAGGGGGACCTGGGG - Intergenic
1182920730 22:34076583-34076605 TGTCCCAGGAAGGGGTCTTCTGG + Intergenic
1183219573 22:36504035-36504057 TCCCCTAGGGAGGGGTCAGGAGG + Intronic
1183454191 22:37912524-37912546 TGGCCCAGGGGGTGGCCCTGGGG + Intronic
1183458584 22:37936152-37936174 GGCCCCTGGGGGTGGTCCTGTGG + Intronic
1183701508 22:39453812-39453834 TGCCCCAGGGAGGTGGAATGCGG + Intergenic
1183936269 22:41264230-41264252 TTGCCCAGGGAGGTGTCCTCAGG - Intronic
1184091212 22:42293958-42293980 TGGCCCAGGGTGGAGTGCTGTGG - Intronic
1184119256 22:42439824-42439846 TGCCCCAGGGGAGTTTCCTGGGG - Intergenic
1184128703 22:42504571-42504593 AGCCCCAGGCAGTGGGCCTGAGG + Intergenic
1184137498 22:42557886-42557908 AGCCCCAGGCAGTGGGCCTGAGG + Intronic
1184210941 22:43035297-43035319 TGCCCCAGTGGAGGGCCCTGGGG - Intergenic
1184565393 22:45288846-45288868 TGATCCAGGGAGGGGTCCTGGGG + Intronic
1184669890 22:46007043-46007065 TGGCCCAGGGGGGCCTCCTGCGG - Intergenic
1184913616 22:47552104-47552126 TGCCCCATGAAGGGGCTCTGGGG - Intergenic
1185040971 22:48504224-48504246 TAACCCAGGGTGGCGTCCTGGGG + Intronic
1185050917 22:48553541-48553563 CGTCCCAGGGATGAGTCCTGGGG + Intronic
949244715 3:1913653-1913675 TGTCCCATGGTGGGGGCCTGGGG - Intergenic
949540266 3:5026888-5026910 TGTCCCAGGGAGGGGGCTGGAGG - Intergenic
950281353 3:11710683-11710705 TAGCTCAGGGAGTGGTCCTGGGG - Intronic
950316517 3:12005551-12005573 TGCAGCAGGGAGGGGACGTGTGG + Intronic
950467424 3:13163499-13163521 TGCCCCAGCCACGGGGCCTGAGG - Intergenic
950565565 3:13767844-13767866 GGCCCCAGGCAGGGGTCAGGAGG - Intergenic
950579678 3:13854039-13854061 TGCCCCAGGATGGTGTCCTGGGG - Intronic
952832538 3:37577034-37577056 GACCCCAAGGATGGGTCCTGAGG - Intronic
954235895 3:49256950-49256972 TGCCCCAGGAAGGGGCTTTGAGG - Exonic
954697954 3:52437431-52437453 AGCCCCAGAAAGGGGTTCTGGGG - Intronic
954792802 3:53145459-53145481 CACCCCAGGGAGGGGTCCTGGGG - Intergenic
955911359 3:63863215-63863237 TGACACCAGGAGGGGTCCTGGGG - Intronic
956366190 3:68505734-68505756 TGCCTGTGGGAGGGGTCTTGTGG - Intronic
958843232 3:99233922-99233944 TAGCCCAGGGAGGGATTCTGGGG + Intergenic
961886975 3:130102864-130102886 TGTCCCTGGTCGGGGTCCTGCGG - Intronic
962198103 3:133380419-133380441 AGCCCCAGAGTGGGGTCCTGGGG - Exonic
962876726 3:139540967-139540989 AGCCCCAGGGAGGCACCCTGGGG - Intergenic
964176353 3:153828544-153828566 TGACCAAGGCAGGTGTCCTGTGG + Intergenic
965561089 3:170062952-170062974 TCCACCATGGAGGGGTCCCGTGG - Intronic
967022849 3:185537711-185537733 TGCCCAAGAGAGGAATCCTGGGG + Intronic
968497423 4:926410-926432 AGCCCCAGGGAGGTGTCCTTAGG - Intronic
968581143 4:1396001-1396023 TGACCAAGTGAGGGGCCCTGTGG + Intergenic
968705709 4:2076471-2076493 TGCCCCCGGGAGGGGACGTGCGG + Intronic
968771900 4:2512822-2512844 GGCCCCAGACAGGGATCCTGGGG + Intronic
968816093 4:2822757-2822779 GGCCCCAGAGTGGGCTCCTGGGG + Intronic
968904077 4:3443682-3443704 TGCCCCAGGCAGGGGACAGGTGG + Intronic
969656652 4:8502674-8502696 TGGCCCTGGGAGAGGGCCTGTGG - Intergenic
969690999 4:8704149-8704171 AGGGCCAGGGAGGGGGCCTGAGG - Intergenic
969928004 4:10603504-10603526 TGCCGCAGGTTGGGCTCCTGAGG + Intronic
972247138 4:37257080-37257102 TGCCCCATGGACGGACCCTGTGG + Intronic
974256820 4:59467688-59467710 TTGCCCAGGCAGGGGTGCTGTGG - Intergenic
976673881 4:87683256-87683278 TGCCCCATGGAGAGGCCATGTGG - Intergenic
978964699 4:114726094-114726116 TGCAGCAGGGAGGTGTGCTGGGG - Intergenic
982809027 4:159803353-159803375 GGCACCAGGGAGGGGTTTTGTGG + Intergenic
984844416 4:184097820-184097842 TGCTACTGAGAGGGGTCCTGGGG + Intronic
985756899 5:1724682-1724704 AGGCCCAGGGAGGACTCCTGCGG + Intergenic
985896900 5:2754033-2754055 TGCCCCTGGCAGAGGTCCGGCGG - Intronic
986102563 5:4627224-4627246 TGCTTCAAGGAGGGGTCCTCAGG - Intergenic
986313997 5:6573991-6574013 TTCCCCAGGGTGGGGACGTGGGG - Intergenic
986510917 5:8505402-8505424 TGTCCCAGAAGGGGGTCCTGTGG - Intergenic
986676525 5:10190370-10190392 TCCTCCAGGGAGAGGCCCTGTGG + Intergenic
986988348 5:13524073-13524095 TGCCCACGGGAGGGGTTGTGGGG + Intergenic
987476059 5:18393686-18393708 TGCCTCAGGCAAGGCTCCTGAGG - Intergenic
988683211 5:33503190-33503212 TGCCACAGAGAGGAGACCTGGGG + Intergenic
989227504 5:39047198-39047220 TGGCCCAGGGACTGGTTCTGTGG + Intronic
992589827 5:78282960-78282982 TGCCCCAGGCTGGGGTGCAGTGG - Intronic
992635820 5:78725130-78725152 CGCCCCAGGGTGGAGTGCTGTGG - Intronic
996597758 5:125225510-125225532 TGTGCCAGTGAGGGGACCTGGGG - Intergenic
997196916 5:131986336-131986358 TGCCCCCGGGATGGGCCATGTGG - Intronic
997721448 5:136080975-136080997 TGCCAAAGGCAGGGGTTCTGTGG + Intergenic
998176434 5:139904622-139904644 GGGCCCAGGGAGGGGGCCTAGGG - Intronic
999177292 5:149640425-149640447 TGCCCCAGGGGAGAGGCCTGGGG - Intergenic
1001028106 5:168241293-168241315 TCCCCCAGGGTGGGGTGCAGTGG + Intronic
1001282163 5:170394168-170394190 GGCCCCAGCGGGGAGTCCTGTGG - Intronic
1001638856 5:173231486-173231508 GACCCCAGAGAGGTGTCCTGCGG - Intergenic
1001774336 5:174317341-174317363 CCCCCCAGGGAGGGGTCCCAGGG + Intergenic
1002065640 5:176650420-176650442 TGCCCCGGGGATTGGTCCAGAGG - Intronic
1002154606 5:177266542-177266564 TGCATCATGGAGGTGTCCTGTGG - Intronic
1003076383 6:2987050-2987072 GGCACCAGGGAGGGGTTTTGTGG + Intergenic
1004008741 6:11660652-11660674 AGCCCCAGGGAGGTGTCAGGGGG + Intergenic
1004115470 6:12762668-12762690 TGGCACAGGGAGGAGTTCTGAGG - Intronic
1004482213 6:16031766-16031788 TGCAGCAGAGAGGGGGCCTGAGG - Intergenic
1006136037 6:31897145-31897167 GGCCCGGGGGAGGGGTCGTGCGG - Intronic
1006190176 6:32202554-32202576 AGCCGCAGGAAGGGGCCCTGTGG + Exonic
1006446813 6:34084345-34084367 TGCCCCACTGATGGCTCCTGAGG - Intronic
1007415529 6:41689229-41689251 TGCCAGAGGGAGTGTTCCTGTGG + Intronic
1011797049 6:90967954-90967976 TGTCCCAGGGATAAGTCCTGAGG - Intergenic
1012241356 6:96876451-96876473 TGCCCCAGGGAGTGCTATTGTGG - Intergenic
1013626602 6:111943862-111943884 TGCCCCAGGGAGTGGGGCAGGGG - Intergenic
1014706465 6:124753768-124753790 TGCCCCAGGGAGGTGTAATTGGG + Intronic
1015004534 6:128263090-128263112 TGGCCCAGGGAGCGTTCCTGTGG - Intronic
1015519661 6:134117650-134117672 TGCCACAGGGACGTCTCCTGGGG + Intergenic
1015716999 6:136203048-136203070 TGCCCCAGGCAGGAGTGCAGTGG - Intergenic
1016989320 6:149918509-149918531 AGCCCCTGGGAGAGTTCCTGGGG + Intronic
1017070703 6:150573363-150573385 GGCCCCAGGCAGGGGGGCTGGGG + Intergenic
1017614536 6:156230369-156230391 TGATGCAGGCAGGGGTCCTGTGG - Intergenic
1018952969 6:168391100-168391122 TGCCCTTGGGAGGGCCCCTGAGG - Intergenic
1018986178 6:168638695-168638717 TGCCCCGGGCTGGGGGCCTGGGG + Intronic
1019100661 6:169626513-169626535 TTCCCCAGGAGGTGGTCCTGGGG - Intronic
1019129540 6:169863351-169863373 AGCCCCAGGGATGTGTCCTTGGG - Intergenic
1019129621 6:169864299-169864321 AGCACCAGGGAGGGGGCGTGAGG - Intergenic
1019323652 7:426715-426737 TCCCCCAGGGAGAGTCCCTGAGG - Intergenic
1019499793 7:1359129-1359151 AGGCTCAGGGAGGGGCCCTGGGG - Intergenic
1019512711 7:1426038-1426060 TGAGCCAGGCAGGGGCCCTGAGG - Intergenic
1019533224 7:1513989-1514011 TGGCGCAGGGAGGGGGCCCGTGG + Intergenic
1019982128 7:4629438-4629460 TGGCCCAGGGAGGGGGGTTGAGG - Intergenic
1020271948 7:6602149-6602171 TGGCCCAGCTAGGAGTCCTGAGG - Intronic
1021627608 7:22609689-22609711 GGCCCCAGGGTGGAGCCCTGAGG - Intronic
1023617846 7:42038584-42038606 GTGCACAGGGAGGGGTCCTGGGG - Intronic
1023797789 7:43808197-43808219 TGCCACAGGGAGAGGGGCTGAGG - Intergenic
1023831895 7:44044474-44044496 GTCCTCAGGGAGGGATCCTGGGG - Intergenic
1023879532 7:44310334-44310356 GGCCCCAGGAAGTGGTTCTGTGG - Intronic
1023970366 7:44986510-44986532 GAGCCCAGGTAGGGGTCCTGGGG - Intergenic
1023983683 7:45083296-45083318 TGCCCCAGGGACAGAGCCTGTGG - Exonic
1033742171 7:144284011-144284033 TGGCCCAGGGAGGTCACCTGTGG - Intergenic
1033751731 7:144365603-144365625 TGGCCCAGGGAGGTCACCTGTGG + Exonic
1033789647 7:144776027-144776049 TGTCGCAGGGATGGGGCCTGTGG - Intronic
1034385440 7:150737153-150737175 TGCCCCGGTGATGGGTGCTGAGG + Intronic
1034420402 7:150987535-150987557 TGCCCCAGGGAGCCCACCTGAGG - Intergenic
1035022109 7:155806060-155806082 TGCCCCGAGATGGGGTCCTGTGG - Intronic
1035677791 8:1467400-1467422 AGCTCCTGGGAGGTGTCCTGAGG - Intergenic
1035683039 8:1502855-1502877 TGCCCCAGAGAAGGCCCCTGGGG - Intronic
1035687859 8:1538830-1538852 TGCCTCAGGGTGGGGATCTGAGG - Intronic
1037471597 8:19216155-19216177 GGCCCCAGGAAGGGGAGCTGAGG - Intergenic
1038151129 8:24942800-24942822 TGCCCCCGGGGGGCATCCTGGGG + Intergenic
1039069849 8:33639919-33639941 TCCCCCAGGCAGGAGTCCAGTGG - Intergenic
1040549973 8:48430168-48430190 TGCCCCAGGGAGGGGTCTGTGGG + Intergenic
1042695159 8:71547630-71547652 TGCCCCGGGGTGGGGCCCAGGGG + Exonic
1042872496 8:73411340-73411362 TGCCCCACGCAGGTGTCCTGAGG - Intergenic
1045749666 8:105468213-105468235 TACCCCTGGGAAGAGTCCTGAGG - Intronic
1048447560 8:134503186-134503208 TGCTCCATGGAGGACTCCTGGGG + Intronic
1048881794 8:138877674-138877696 AGCCCACGGGAGGGGTCCTCGGG - Intronic
1048971112 8:139645396-139645418 TGGCCCAGGGAGGGGCCTTCAGG + Intronic
1049212998 8:141395350-141395372 TGCCCCACCTAGGGGTCCTTAGG - Intronic
1049579685 8:143405622-143405644 GGTCCCAGTGAGGGGTCCTCGGG - Intergenic
1049749517 8:144276673-144276695 GGCCCCTGGGAGGAGTCCTGTGG - Intronic
1049760881 8:144331620-144331642 TGCCTGAAGGAGGGGTCTTGGGG + Exonic
1049883623 9:14039-14061 GCCCCCAGGCAGGGGCCCTGTGG - Intergenic
1052990669 9:34517795-34517817 TCACCCAGGCAGGGGGCCTGGGG + Intronic
1053141708 9:35686595-35686617 TTTCCCAGGCAGGGCTCCTGGGG - Intronic
1053350978 9:37413066-37413088 CGCCCCAGGGAGGAAACCTGAGG + Intergenic
1053576950 9:39363498-39363520 TTCCCCAGGGAGCAGTCCTGGGG - Intergenic
1053841456 9:42191423-42191445 TTCCCCAGGGAGCAGTCCTGGGG - Intergenic
1054098520 9:60922188-60922210 TTCCCCAGGGAGCAGTCCTGGGG - Intergenic
1054119919 9:61197817-61197839 TTCCCCAGGGAGCAGTCCTGGGG - Intergenic
1054587837 9:66984745-66984767 TTCCCCAGGGAGCAGTCCTGGGG + Intergenic
1055216683 9:73872168-73872190 TGCACAAGGGAGGAGTGCTGGGG - Intergenic
1055473140 9:76633540-76633562 TGCCCCAGGCTGGAGTGCTGTGG - Intronic
1057496115 9:95562723-95562745 TTGCCCAGGGTGGGGGCCTGGGG + Intergenic
1057797964 9:98171806-98171828 TGCCGCTGGGAGAGGTGCTGGGG + Intronic
1057833772 9:98427814-98427836 AGCCCTGTGGAGGGGTCCTGAGG + Intronic
1060484283 9:124037314-124037336 TGCCCCAGGGAGGGACATTGTGG + Intergenic
1060816079 9:126635956-126635978 TGGCCCAGGGAGGAGCACTGGGG + Intronic
1061130582 9:128705743-128705765 TGCCCACGGCCGGGGTCCTGAGG - Exonic
1061379171 9:130243868-130243890 TGCCCCAGGGAGGGGTCCCCAGG + Intergenic
1061508954 9:131048933-131048955 AGCCCCAGGTGGGGGCCCTGGGG - Intronic
1061905458 9:133694438-133694460 TGCCCCTGTGAGCGGCCCTGGGG - Intronic
1062221701 9:135419506-135419528 TGCACCAGGGAGGTTTCCTTTGG - Intergenic
1062467006 9:136685979-136686001 TGGCCCAGGCCGGGGTCCCGGGG - Intronic
1062519473 9:136951750-136951772 AGGACCAGGGAGGGGCCCTGTGG - Intronic
1185736895 X:2501613-2501635 TGCCCCAGTGGGGGGGCCTGTGG - Intronic
1187098561 X:16170030-16170052 TGACATAGGGAGGGATCCTGAGG - Intronic
1187526651 X:20060777-20060799 TGTCCCAGGGAGGGGTCCCAGGG - Intronic
1188916707 X:35920115-35920137 TGCCCCAGGGAGTAGTCATCTGG + Intronic
1190984547 X:55489062-55489084 GGCCGATGGGAGGGGTCCTGGGG - Intronic
1192578781 X:72263755-72263777 TGCCCATGTGAGGGGTACTGAGG + Intronic
1193307431 X:79966065-79966087 TGGCCCAGGCTGGAGTCCTGTGG + Intergenic
1195134012 X:101885496-101885518 TGGCCCAGGGTGGAGTCCAGTGG - Intronic
1195229473 X:102831706-102831728 AGCCCCAGTGTGGGTTCCTGGGG + Intergenic
1197262717 X:124334427-124334449 TCCCCCAGGGGAGTGTCCTGGGG - Intronic
1197262766 X:124334613-124334635 TCCCCCAGGGGAGTGTCCTGGGG - Intronic
1197418678 X:126208905-126208927 TGCCCCAGGCTGGGGTGCAGTGG + Intergenic
1197776527 X:130121801-130121823 TGCCCAAGGGAAGGGGTCTGGGG + Intergenic
1197873763 X:131083589-131083611 CTCCCCAGGGAGGGGCGCTGCGG + Intronic
1198387961 X:136147133-136147155 TGCGCGAGGGAGGGGGCCCGAGG + Intergenic
1198827324 X:140713074-140713096 GGGCCAGGGGAGGGGTCCTGAGG + Intergenic
1200402195 X:156026110-156026132 GCCCCCAGGCAGGGGCCCTGTGG + Intergenic
1201571934 Y:15424090-15424112 TCACCCAGTGAGGAGTCCTGGGG + Intergenic