ID: 1164721788

View in Genome Browser
Species Human (GRCh38)
Location 19:30437915-30437937
Sequence CAGTGAGAACAGCTTGCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164721788_1164721789 15 Left 1164721788 19:30437915-30437937 CCAGGGGCAAGCTGTTCTCACTG No data
Right 1164721789 19:30437953-30437975 GCTTGCTTTTAATTGTGCTAAGG 0: 1
1: 0
2: 1
3: 15
4: 162
1164721788_1164721790 16 Left 1164721788 19:30437915-30437937 CCAGGGGCAAGCTGTTCTCACTG No data
Right 1164721790 19:30437954-30437976 CTTGCTTTTAATTGTGCTAAGGG 0: 1
1: 0
2: 1
3: 17
4: 216
1164721788_1164721791 30 Left 1164721788 19:30437915-30437937 CCAGGGGCAAGCTGTTCTCACTG No data
Right 1164721791 19:30437968-30437990 TGCTAAGGGTTTTTCTGCCCAGG 0: 1
1: 0
2: 0
3: 5
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164721788 Original CRISPR CAGTGAGAACAGCTTGCCCC TGG (reversed) Intronic
No off target data available for this crispr