ID: 1164727515

View in Genome Browser
Species Human (GRCh38)
Location 19:30476184-30476206
Sequence CTGGGGCCACAGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 800
Summary {0: 1, 1: 0, 2: 2, 3: 84, 4: 713}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164727515_1164727522 5 Left 1164727515 19:30476184-30476206 CCTTCTTCCCTCTGTGGCCCCAG 0: 1
1: 0
2: 2
3: 84
4: 713
Right 1164727522 19:30476212-30476234 ATCCACTCCCCAGCGCACCTGGG 0: 1
1: 0
2: 0
3: 12
4: 121
1164727515_1164727521 4 Left 1164727515 19:30476184-30476206 CCTTCTTCCCTCTGTGGCCCCAG 0: 1
1: 0
2: 2
3: 84
4: 713
Right 1164727521 19:30476211-30476233 CATCCACTCCCCAGCGCACCTGG 0: 1
1: 0
2: 1
3: 16
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164727515 Original CRISPR CTGGGGCCACAGAGGGAAGA AGG (reversed) Intronic
900165812 1:1243896-1243918 GTGGGGCCCCACAGGCAAGACGG - Intronic
900293940 1:1939312-1939334 CTGGGGCCACACAAGGTAGCTGG - Intronic
900465350 1:2822557-2822579 GTTGGGCCGCAGAGGGCAGAGGG + Intergenic
900539881 1:3197328-3197350 CTGGGGGCACACAGGAAGGAGGG - Intronic
900586169 1:3433332-3433354 CCTGGGCCACAGGGGGCAGAAGG - Intronic
900954492 1:5878118-5878140 CTGGTGCCAGAGAGTGAGGAAGG - Intronic
901199717 1:7459771-7459793 CTTGGGTCACAGCCGGAAGAAGG + Intronic
901640500 1:10690712-10690734 CAAGGGCCAAAGAGGCAAGAGGG - Intronic
901816901 1:11799493-11799515 CTGTGGCCCCAGAGGGAATGAGG + Intronic
901915772 1:12498774-12498796 GTGGGGACACAGTGAGAAGAGGG - Intronic
902115865 1:14120563-14120585 CTGGGCCCAGTGAAGGAAGACGG - Intergenic
902610710 1:17595662-17595684 GGGCGGCCACAGAGGGAAGAGGG + Intronic
902982589 1:20136456-20136478 GTGAGGCCACAGAGCGAAGGTGG + Intergenic
903569650 1:24294921-24294943 TCTGGGCCACAGAGGGAAGTGGG - Intergenic
904337959 1:29810283-29810305 CTGGGACCAGAGAGGGAGGGAGG - Intergenic
904495579 1:30884562-30884584 CAGGTGCCACAGTGGGAAAAAGG - Intronic
905037041 1:34925192-34925214 CTTGGGACATAGAGGGAAGGTGG - Intronic
905125844 1:35715874-35715896 CCTGGGCCACTGAGGGCAGAAGG + Exonic
905232855 1:36525862-36525884 GTGTGGCCGCAGAGGGCAGAAGG - Intergenic
905245927 1:36613264-36613286 CTGTGGCCACAGAGGCAGAAAGG - Intergenic
905461070 1:38123366-38123388 ACGGTGCCACAGAGGAAAGAAGG - Intergenic
905774973 1:40662563-40662585 CTTCTGCCACAGAGGCAAGAGGG + Intronic
906617511 1:47244009-47244031 CTGGGGCCACAAAGGGGTGAGGG - Intergenic
907526218 1:55055710-55055732 CTGAGGCCTCCCAGGGAAGAAGG - Intronic
908096624 1:60746321-60746343 CTGGGGCCAGAGAGGAGAGCTGG + Intergenic
908685724 1:66717228-66717250 TTGAGGCCACAGTGGTAAGAGGG - Intronic
909594798 1:77394427-77394449 CTGGTCCCAGAGAGGGAAGGAGG - Intronic
909681251 1:78294487-78294509 CTGTGGCTTCAGAGGGTAGAAGG + Intergenic
911355157 1:96808379-96808401 ATGAGGACACAGGGGGAAGATGG - Intronic
911430636 1:97782340-97782362 CTGGGGCCACAGAAGAAAATGGG - Intronic
911566700 1:99470895-99470917 CTGGGGCCACTGCGGGGAGGGGG + Intergenic
911850532 1:102813598-102813620 CAGGGGCAAAAGTGGGAAGAGGG - Intergenic
913109712 1:115647002-115647024 CTGGGGCTAGAGAAGGAGGAGGG + Intronic
913217518 1:116632813-116632835 GTGGGGCCACAGAGAGAAAGGGG + Intronic
913498479 1:119449500-119449522 CTGAGGGCAAAGAAGGAAGAAGG - Intergenic
913569964 1:120110197-120110219 CTAGGGCCGCGCAGGGAAGACGG + Intergenic
913996599 1:143655909-143655931 CTGAAGACACAGTGGGAAGACGG - Intergenic
914290772 1:146271162-146271184 CTAGGGCCGCGCAGGGAAGACGG + Intergenic
914551816 1:148721945-148721967 CTAGGGCCGCGCAGGGAAGACGG + Intergenic
915089890 1:153416914-153416936 CTGCCCCCACAGAGGGAGGAGGG + Intronic
915128931 1:153683890-153683912 GTGGGGACCCAGAGGGAAGAGGG + Intronic
915196774 1:154195399-154195421 CATTCGCCACAGAGGGAAGAGGG + Intergenic
915218038 1:154352932-154352954 CTGGGAGCACAGATGGAAGCGGG - Intergenic
915219878 1:154366239-154366261 CTGGGGCGGCAGAGGGACGTGGG - Intergenic
915577487 1:156789560-156789582 TTGGGGCCAAGGAGGAAAGAAGG + Intronic
916167689 1:161978368-161978390 CTGGGGATACAGAAGGCAGAGGG - Intergenic
916375851 1:164152503-164152525 CTTGGGCGACAGAGTGAAAAAGG - Intergenic
916506076 1:165429142-165429164 CGAGGGACACAGAGGGGAGAGGG + Intronic
917218380 1:172701705-172701727 GTGGGAACACAGAGGGAAAATGG + Intergenic
918081805 1:181213614-181213636 CTGTGGTCTGAGAGGGAAGAAGG + Intergenic
918202485 1:182280196-182280218 CTGGGGCCACATGCAGAAGAGGG - Intergenic
918501974 1:185207337-185207359 CTGCTGCCACAGATGGATGATGG + Intronic
919661724 1:200254233-200254255 CCAGAGCCACAGAGGGAAGGGGG + Intergenic
919786465 1:201261463-201261485 CTGGAGCTACTGGGGGAAGAGGG - Intergenic
919793282 1:201305972-201305994 CTGGGGCCATGGAAGGGAGATGG + Intronic
920290954 1:204922945-204922967 ATGGGGCCACTGTGGGAGGATGG - Intronic
920294911 1:204950176-204950198 CTGATGCCACTGAGGGAAGTGGG - Intronic
920940459 1:210477348-210477370 CTAGGGAAACAGTGGGAAGAAGG - Intronic
922415563 1:225419227-225419249 CTGGGCCCAGAGAGGGCAGGTGG - Intronic
922739925 1:228009036-228009058 CTTTGGCCACACAGGGAAGCGGG + Intronic
923006221 1:230052186-230052208 GTGAGGACACAGAGAGAAGATGG + Intergenic
923055658 1:230424919-230424941 CTGTGGCCACAGTGGTAAGCAGG + Intronic
923079690 1:230641953-230641975 CTGGGAACTCATAGGGAAGAAGG - Intergenic
923087291 1:230711296-230711318 GTGGGGACACAGAGAGAAGACGG + Intronic
923105938 1:230853912-230853934 CTGGGGCCAGAGTGGGAAACAGG - Intronic
923783697 1:237048047-237048069 CTGGGGTCCGAGAGGCAAGAGGG - Intronic
1063309740 10:4940991-4941013 CTGAGGCTACAGAGAGAACAGGG + Intronic
1063324081 10:5079739-5079761 CTGAGGCTACAGAGAGAATAGGG - Intronic
1063483768 10:6400207-6400229 CTGGGGCTACAGATGAAAGAAGG - Intergenic
1064156493 10:12907318-12907340 ATGGGGCTTCACAGGGAAGATGG - Intronic
1064392974 10:14957486-14957508 CCGGGGCTACAGAGGAAGGAGGG + Intergenic
1065205610 10:23355183-23355205 CTGTGGCCACAGAGGAGAGAAGG - Intergenic
1065535679 10:26712805-26712827 CTGGGGCCACTGAGGCTGGAGGG - Intronic
1065708733 10:28495208-28495230 CTGGGAAGACAGAGGGAAGGAGG + Intergenic
1065752836 10:28903477-28903499 TAGGGGCCACAGAGGAATGAAGG + Intergenic
1065965458 10:30766918-30766940 CTGTGGCCACAAAGGAAAGATGG - Intergenic
1066654131 10:37683362-37683384 CTGGGACAACATAGGGAAGCAGG + Intergenic
1067514705 10:46928566-46928588 CTGGGGGCTCAGAGGGAAGCAGG - Intronic
1067647551 10:48123247-48123269 CTGGGGGCTCAGAGGGAAGCAGG + Intergenic
1069103084 10:64348029-64348051 CTGGAGCCACTGCAGGAAGATGG - Intergenic
1069312066 10:67050559-67050581 CTCGAGCTACAGAGGGAAGGTGG - Intronic
1069589687 10:69634141-69634163 TCTGGGCCACAGAGGGAGGAGGG + Intergenic
1069860326 10:71467146-71467168 CAGAGACCCCAGAGGGAAGAGGG + Intronic
1069871092 10:71533574-71533596 CTGGGGCTGCAGAGGCCAGAAGG + Intronic
1069879547 10:71583268-71583290 CTGAGGCCGCAGAGGGAGGCAGG + Intronic
1069887976 10:71635896-71635918 GTGGGGACACAGTGGGAAGCAGG - Intronic
1070742059 10:78909728-78909750 CTGGGACCACAGAGTGGAGAAGG + Intergenic
1070781202 10:79138329-79138351 GTGGGTCCACAGAGGCCAGAAGG - Intronic
1071133595 10:82426197-82426219 CAGGGGTCTCAGAGTGAAGATGG - Intronic
1071341687 10:84654680-84654702 CTGGGGACATAGAGGGTAAAAGG - Intergenic
1072205838 10:93204700-93204722 ATGGGGCCTGAGAGGGAAGCTGG + Intergenic
1072660880 10:97362828-97362850 CTCGGGCCACACTGGGCAGATGG + Intronic
1072687541 10:97547388-97547410 CTGGGGCAGAAGAGGGAGGATGG - Intronic
1072785036 10:98273562-98273584 CTGGGGGTGCAGGGGGAAGAGGG - Intergenic
1073560903 10:104496037-104496059 CTGGGGCCACATATGGAGGGAGG - Intergenic
1073930474 10:108568265-108568287 GTGGGGCAACAGAGTGAAGAAGG - Intergenic
1074544702 10:114393579-114393601 CTGGGGACAGGGAGGGAAGTTGG + Intronic
1074547070 10:114409318-114409340 CTGGGGCAAGAGAGGAAAGGGGG - Intergenic
1075004007 10:118817682-118817704 TTGGGAACACAGAGGGCAGAAGG + Intergenic
1075335291 10:121604509-121604531 CAGGGCACACAGAGGGATGATGG + Intergenic
1075579905 10:123609535-123609557 CTGGGGCCACAGACAGAAGGGGG - Intergenic
1075712599 10:124538549-124538571 ATGGGGCCACAGCGGGCAGGGGG - Intronic
1075805791 10:125187926-125187948 GTGGGGCTAAAGAGGGAGGAGGG - Intergenic
1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG + Intergenic
1076296315 10:129387533-129387555 TTGGGCCCACAGAGGACAGAGGG + Intergenic
1076533393 10:131160343-131160365 CTGGGAGCACAGAGGAAGGATGG - Intronic
1076583367 10:131529933-131529955 CTGGGGCCAATGAGGGCAGGAGG + Intergenic
1076764872 10:132627541-132627563 CTGGGGACACAGAGGGAGTCGGG - Intronic
1076799981 10:132816871-132816893 CTGAGGCCACAGCGTGATGAGGG - Intronic
1076820548 10:132936713-132936735 GTGAGGCCACAGAAGGGAGAGGG - Intronic
1076911984 10:133394897-133394919 CTGGGGGCCGAGGGGGAAGAAGG + Intronic
1077046578 11:549350-549372 CTGTGGCTACAGTGGGAACAGGG + Intronic
1077532518 11:3103867-3103889 ATGGGGCTACAGAGGCAGGAAGG - Intronic
1077890295 11:6413436-6413458 CTGAGAACACAGAGGGAAGGGGG - Intronic
1078466559 11:11554334-11554356 AGGGGGCCACAGAGAGAAGTGGG + Intronic
1078513963 11:12007841-12007863 GTGGGGGCAGAGAGGGAAGATGG - Intronic
1078901850 11:15649938-15649960 CTGGGGACACAGGGGCACGAGGG - Intergenic
1078930887 11:15911373-15911395 TTGGAGCCATGGAGGGAAGAAGG + Intergenic
1079241240 11:18723626-18723648 CTGGGGCCAGACTTGGAAGAGGG - Intronic
1080688716 11:34537725-34537747 CAGAGGTCACAGAGGGAAGACGG - Intergenic
1081666370 11:44919191-44919213 CTGGGGGCAGAGGGAGAAGATGG - Intronic
1081734626 11:45394308-45394330 TTGTGGGCACAGAGGGTAGAGGG + Intergenic
1082824574 11:57568179-57568201 CTGGGCCCATGGAGGGAAGGCGG - Intronic
1083402178 11:62431117-62431139 TTGAGGCCACAGTGGGAAGCAGG - Intergenic
1083869352 11:65477456-65477478 CTGGGGACACGGCAGGAAGAAGG + Intergenic
1084013517 11:66365712-66365734 CTGGGGACACAGAGGTCAGCTGG + Intronic
1084101870 11:66955205-66955227 CTGAGAGGACAGAGGGAAGAGGG + Intronic
1084698293 11:70769264-70769286 CTGGGGCCACCGCGTGAAGCAGG - Intronic
1084815240 11:71641921-71641943 CTTGGTCCACAGAGGGAAATGGG + Intergenic
1084887533 11:72220956-72220978 CTGGGACCACTGCGGCAAGATGG + Exonic
1085711303 11:78831319-78831341 CTGGGGCCATAGAGGGAGTTAGG - Intronic
1085751612 11:79167233-79167255 CTGAGTTCACAGTGGGAAGAAGG + Intronic
1086957263 11:92946225-92946247 GTGGGGCAACAGAGGGTAGAAGG + Intergenic
1087541157 11:99522049-99522071 ATGGGGCCACAGAGGAAAACTGG + Intronic
1088058374 11:105611875-105611897 ATAGTGCCACACAGGGAAGAGGG - Intronic
1089508449 11:118980275-118980297 CTGGGCCCTCAGAGGGAGGGAGG + Intronic
1089537481 11:119169389-119169411 CTAGGGCCACTGAGTCAAGACGG - Intronic
1089689604 11:120179107-120179129 CAAGGGCCAGAGAGGGAAGCTGG + Intronic
1090430738 11:126644295-126644317 CTGGAGCCACCAAGGGAAGTGGG + Intronic
1090745798 11:129703982-129704004 ATGGGGCCTGAGAGGGGAGATGG - Intergenic
1090964455 11:131585816-131585838 CTGGAGCCACAGTGGGAAAAAGG - Intronic
1091311004 11:134575140-134575162 CTGAGGACACAGCGAGAAGACGG + Intergenic
1091393561 12:140155-140177 CTGTGACCACAGAGGTGAGAAGG + Intronic
1091835464 12:3582769-3582791 TTGGGGCTACAGGGGGATGATGG - Intronic
1092802020 12:12177951-12177973 CTGGTACCATACAGGGAAGAAGG + Intronic
1093742697 12:22706425-22706447 GTGGGGCAACAAAAGGAAGAAGG + Intergenic
1094064787 12:26350953-26350975 ATAGAGCCACAGAGAGAAGAGGG + Intronic
1095184613 12:39187047-39187069 CTGGGGACCCAGAAGGGAGATGG - Intergenic
1095413475 12:41948957-41948979 GAGGGGCCAGGGAGGGAAGAAGG + Intergenic
1097307151 12:58081754-58081776 CTGGTGACACAGAGGTAACAAGG + Intergenic
1097861715 12:64524406-64524428 CTTGGAGGACAGAGGGAAGAGGG - Intergenic
1099222929 12:79935299-79935321 CTGGGCCACCAGAGGGAAGCGGG + Intronic
1099627168 12:85090002-85090024 CTGTGGCCACACAGGGCAGTGGG - Intronic
1100874916 12:98951669-98951691 CTGTAGGCCCAGAGGGAAGAGGG - Intronic
1102006147 12:109590467-109590489 CCGGGGCCAGAGAGGGGATAGGG - Intronic
1102024153 12:109703979-109704001 CTGGAGCTGCAGTGGGAAGATGG - Intergenic
1102438918 12:112946703-112946725 CAGGGGACTCAGAAGGAAGAAGG - Intronic
1102440892 12:112963290-112963312 CTGGGGGCACAGCAGGAAGGTGG - Intronic
1102612303 12:114123035-114123057 CAGGGGTCACAGCTGGAAGAGGG + Intergenic
1102647546 12:114413758-114413780 CTGGGGCCTCAGTGGGAATGGGG - Intergenic
1102655804 12:114481333-114481355 CTGGCGCTGCAGAGGGAGGAAGG + Intergenic
1103014478 12:117483024-117483046 CTGGGGAGTCAGAGGGAAGAAGG + Intronic
1103024550 12:117562996-117563018 CTCTGGAGACAGAGGGAAGAGGG + Intronic
1103239785 12:119403599-119403621 CAGAGGGCACAGGGGGAAGATGG - Intronic
1103796402 12:123506173-123506195 CAGAGGCCACAGAGGAAAGGAGG + Intronic
1103965751 12:124638313-124638335 GTGAGGACACAGTGGGAAGACGG + Intergenic
1104094890 12:125548070-125548092 CTGGGGCCACAGAGAAGGGAAGG + Intronic
1104201821 12:126596973-126596995 ATGGGACCACAGAGAGAAGCTGG - Intergenic
1104254844 12:127127013-127127035 GTGGGGACACAGGGAGAAGACGG - Intergenic
1104734060 12:131125367-131125389 CTGGCCCCACCGAGGAAAGAAGG + Intronic
1104750352 12:131234516-131234538 CTGGGGACACAGAGGAATTAAGG - Intergenic
1104782369 12:131429946-131429968 CTGGGGACACAGAGGAATTAAGG + Intergenic
1104947688 12:132423919-132423941 CTGGATCCACAGAGAGAACATGG + Intergenic
1104970347 12:132528098-132528120 CTGGGGCTCCAGAGGGAAAGCGG - Intronic
1105865054 13:24451691-24451713 CAGGGGCCACAGAGGCAGGCAGG + Intronic
1106079236 13:26486900-26486922 CTGGTGCCACTGTGGGAACAAGG + Intergenic
1106353512 13:28956944-28956966 GTTGGGGGACAGAGGGAAGAAGG + Intronic
1106812832 13:33376931-33376953 CTGGGGCCACTGTGGGGAAAAGG + Intergenic
1107064306 13:36195996-36196018 GTGGTGACACAGAGGGAATAGGG + Intronic
1107790190 13:43994296-43994318 CTGGGGCAAGAGTGTGAAGAAGG - Intergenic
1109229401 13:59738307-59738329 AGGGGACCACAGAGGCAAGAGGG + Intronic
1110282011 13:73704807-73704829 CTGGGGATACAGTGGTAAGAAGG - Intronic
1111681164 13:91443347-91443369 GTGAGGGCACAGAGAGAAGATGG + Intronic
1113125273 13:106971411-106971433 AATGGGCCACAGATGGAAGATGG + Intergenic
1113148904 13:107240213-107240235 ATGAGGACACAGAGAGAAGATGG + Intronic
1113508577 13:110833166-110833188 TTGGGGCCAGAGAGGAGAGAGGG - Intergenic
1113698445 13:112365180-112365202 CTGGGCCCAAAGAGGGTTGAAGG + Intergenic
1113940773 13:114017623-114017645 CAGAGGCCGCAGAGGGGAGAGGG - Intronic
1114080407 14:19198457-19198479 GTGGGGCCTCAGGAGGAAGAGGG + Intergenic
1114493069 14:23115224-23115246 CTGGGATCACAGTGGGGAGACGG + Intergenic
1115569840 14:34656048-34656070 CTGTGGCCAGAGAGTGAGGATGG + Intergenic
1116162530 14:41288327-41288349 CTTGGGCTAAAGACGGAAGAAGG + Intergenic
1116936681 14:50747706-50747728 CCTAGGCAACAGAGGGAAGAAGG + Intronic
1117377538 14:55129624-55129646 CTGGGGCCGCAGAGCGCAGGCGG - Intronic
1118633179 14:67724635-67724657 CAGAGGCCCCAGTGGGAAGAAGG - Intronic
1119325012 14:73754683-73754705 CTGGGGCCTCAGACAGAGGAAGG + Intronic
1119425830 14:74534156-74534178 CTGTGGCCACAGTGGGATGTGGG + Intronic
1119483865 14:74975889-74975911 AAGGGGGCACAGAGGGGAGATGG - Intergenic
1119799126 14:77427041-77427063 CTGGGGCAGCAGAGGGAAAATGG + Exonic
1120081296 14:80219373-80219395 CTGGGGCTACAGATAGAAAACGG - Intronic
1120841739 14:89091677-89091699 GTGGAGCCAGAAAGGGAAGAGGG - Intergenic
1121506911 14:94484533-94484555 CATGGGCCACAGAGGGATGCTGG - Intergenic
1121600383 14:95198993-95199015 CTGGGGGAAGAGGGGGAAGATGG + Intronic
1121627077 14:95393686-95393708 CTGGGGCTCCAGAGGGATAAGGG - Intergenic
1121817500 14:96939874-96939896 CTCGGGCCAGAGAGAGAAGAAGG - Intergenic
1122042604 14:98999690-98999712 CGGGGGGCCCAGAGGGAAGCCGG - Intergenic
1122232909 14:100315985-100316007 CTGGGGCCACAGGTGGGCGAGGG + Intergenic
1122348281 14:101073636-101073658 CTGGGGCTGCAGAGGGAGGCCGG - Intergenic
1122375527 14:101254499-101254521 GTGAGGACACAGAGAGAAGACGG - Intergenic
1122784725 14:104158416-104158438 CTGGGGCCACGGAGAGGACAAGG + Intronic
1123418251 15:20108084-20108106 CTGGGGCCCCTGTGGAAAGAGGG - Intergenic
1123527469 15:21114606-21114628 CTGGGGCCCCTGTGGAAAGAGGG - Intergenic
1123991091 15:25683882-25683904 CTGGGGTCACAGACAGAGGAGGG - Intronic
1124375393 15:29126137-29126159 CTGGGGCCACACTGGGAATGTGG - Intronic
1124516199 15:30369159-30369181 GTGAGGCCACAGCGAGAAGAGGG + Intronic
1124726721 15:32161572-32161594 GTGAGGCCACAGCGAGAAGAGGG - Intronic
1125340559 15:38671543-38671565 CTGGTTCAACGGAGGGAAGATGG - Intergenic
1125588380 15:40838514-40838536 CTGGGGCTAAAGATGCAAGATGG + Intergenic
1126351111 15:47745596-47745618 CTGGGTCCACAGAGGCAAAATGG - Intronic
1127467311 15:59256851-59256873 CTGGGGCCTCAGAGGGAATTAGG + Intronic
1128221215 15:65969983-65970005 CATGTGCCACAGCGGGAAGAAGG - Intronic
1128368018 15:67018433-67018455 CTGGGAACACAGATGGAAGAAGG - Intergenic
1128480289 15:68031551-68031573 CTGGAGGCAGAGAGGGAAGTTGG - Intergenic
1128524304 15:68402085-68402107 CAGGGGCCAGAGTGGGAAGAGGG + Intronic
1128547416 15:68577839-68577861 CTGGGGGAACAGAGAGGAGATGG - Intergenic
1128569908 15:68726459-68726481 CCGGGGCTGCTGAGGGAAGAGGG - Exonic
1129003841 15:72355802-72355824 CTGGGGCCAGAGTGGGAGGGTGG + Intronic
1129009833 15:72405520-72405542 CTAGAGCCAAAGATGGAAGAAGG + Intronic
1129389468 15:75213457-75213479 CTGGGGCCACAGAGGAACCCAGG - Intergenic
1129776064 15:78237230-78237252 CGCGGGCCACAGAGAAAAGATGG + Intronic
1129854217 15:78812142-78812164 CTGGGGCCACGAAGGACAGACGG - Intronic
1129930610 15:79407507-79407529 CTGGAGGCAATGAGGGAAGACGG + Intronic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1130675876 15:85951584-85951606 TTGGGCCCTCAGAGGGAAGCTGG + Intergenic
1130884461 15:88081641-88081663 CTGGGGGCTCAGAAGGAAGGGGG - Intronic
1130985812 15:88843692-88843714 ATGGGGTCCTAGAGGGAAGAGGG + Intronic
1131177220 15:90217638-90217660 AGAGGACCACAGAGGGAAGATGG + Intronic
1132503593 16:296131-296153 CTGGGGCTCCCGAGGGAACAGGG - Intronic
1132554199 16:565451-565473 CTGGGGCCACACAGGGACACTGG + Exonic
1132675040 16:1118047-1118069 CCGCGGCCACACAGGGAAGCAGG + Intergenic
1132697633 16:1209050-1209072 CTGGGGCCCCAGGGGGCACAGGG - Exonic
1132720538 16:1313601-1313623 CTGGGGCCCCAGATGGATGTGGG - Intronic
1132723921 16:1330656-1330678 TTGGGTCCTCAGAGGGAAGTTGG + Intergenic
1132752693 16:1466088-1466110 CTGGGGACATGAAGGGAAGAAGG + Intronic
1133042540 16:3068114-3068136 TGGGGGCCACAGTGGGAAGGGGG + Intronic
1133116045 16:3578575-3578597 ATGGGGCCACTGAGGGAAGGAGG + Intergenic
1133220005 16:4315865-4315887 CTGGGGCCGCAGCGGTGAGAGGG + Intronic
1134453015 16:14374813-14374835 TTGGGGTCATGGAGGGAAGAAGG + Intergenic
1135035650 16:19074781-19074803 GGGAGGCCAGAGAGGGAAGATGG - Intronic
1135407109 16:22206491-22206513 CTGGGGCCACGCGGGGTAGATGG - Exonic
1136086717 16:27890501-27890523 CTGTGGCCACAGTGGGAATGAGG + Intronic
1136655519 16:31706874-31706896 CTGGGGCTGCAGAGGGACCAGGG - Intergenic
1137405474 16:48185818-48185840 CAGGGGCCACAGAGTGACCAGGG - Intronic
1138345042 16:56315567-56315589 CTGGACCCACTGAGGGGAGAAGG + Intronic
1138495889 16:57409181-57409203 CTGGGGACATAGAGGAAGGAAGG + Intronic
1138639763 16:58375508-58375530 CTGGGGCCAAAGAAGGAGGGAGG - Intronic
1138657325 16:58499017-58499039 CAGGAGCCACAGAGAGAAGGGGG - Intronic
1139323715 16:66135353-66135375 CTTGGGGCACAATGGGAAGAAGG + Intergenic
1139662436 16:68430205-68430227 GAGGGGGCATAGAGGGAAGAGGG - Intronic
1140720000 16:77763194-77763216 CTGGGGTAAGAGAGGGAAGGAGG - Intergenic
1140996675 16:80266616-80266638 CTGATGCAACAGAAGGAAGAGGG + Intergenic
1141461370 16:84180345-84180367 CTGGGGCCCGAGAAGGAAGGGGG + Intronic
1141476767 16:84279319-84279341 CTGGGGCCACGGAGGGTGCATGG - Intergenic
1141495414 16:84406423-84406445 CAGGGGCCAGAGAATGAAGAAGG - Intronic
1141780087 16:86153513-86153535 CGTGGTCCAGAGAGGGAAGAGGG + Intergenic
1142281030 16:89147536-89147558 GAGGGGCCACAGAGCGAGGAGGG + Intronic
1142560380 17:805992-806014 CTGTGGCCACCGATGCAAGACGG + Intronic
1142612161 17:1115020-1115042 CTGAGGCCACAGAGGTAGGCAGG + Intronic
1143163622 17:4886715-4886737 CTGGGGCCAAGGAGGGGAGCAGG - Intronic
1143449825 17:7029454-7029476 ATGGGGAGAAAGAGGGAAGAGGG - Exonic
1143465123 17:7131384-7131406 ATGGGGCCAGAGAGGGAGGCAGG + Intergenic
1143495670 17:7311327-7311349 CTGGGGGCAGATAGGGAAGGAGG - Intronic
1144274857 17:13656463-13656485 GTGGGGACACAGAGGGAAGGGGG + Intergenic
1144321184 17:14121894-14121916 CTGAGCCCAGAGAGGGAAGCTGG + Intronic
1146941275 17:36845984-36846006 GTGGGGACAGAGAGGGGAGAGGG + Intergenic
1146945239 17:36869158-36869180 CAGAGGTCACAGAGGGAGGAGGG + Intergenic
1146974329 17:37098083-37098105 GCCAGGCCACAGAGGGAAGAGGG - Intronic
1147167908 17:38603159-38603181 CTGGCGAGAGAGAGGGAAGAGGG + Intronic
1147185714 17:38712133-38712155 CTGAGGCCACTGAGGGCAGGAGG + Intronic
1147833731 17:43315365-43315387 CCGGGGCCACAGAGAGAAGTCGG - Intergenic
1147909837 17:43848927-43848949 CAGGAGCTGCAGAGGGAAGAGGG + Intronic
1148063281 17:44851070-44851092 CAGAGGCCACAGAAGGAAGCAGG + Exonic
1148642720 17:49200545-49200567 CTGAGGCCCCAGAGGTAATAAGG + Intergenic
1148805037 17:50259700-50259722 CTGGGGCCACAGAGTGGGGAGGG - Intergenic
1148806713 17:50267473-50267495 CTGGGGCCGGAGGAGGAAGAGGG + Intergenic
1149535702 17:57431817-57431839 CTGGGGGCAGAGAGTGAAGTGGG - Intronic
1150227627 17:63532397-63532419 CTGGGCACACAGCGGGGAGAGGG + Intronic
1150321382 17:64217256-64217278 CTGGGAGGACAGAGAGAAGAGGG - Intronic
1150619339 17:66797693-66797715 GTGGGGACACAGAGGGGAGAAGG - Intronic
1150639903 17:66942518-66942540 CTGGAGGGACAGAGGGAGGAGGG + Intergenic
1150789943 17:68195833-68195855 CTGGGGCCCCTGAGGGCAGGGGG + Intergenic
1151349617 17:73524119-73524141 CTGGGGCCAGGGAGGGCAAATGG - Intronic
1151357236 17:73567147-73567169 CTGGGGCCGCAGAGGGCAGCAGG - Intronic
1151560391 17:74866636-74866658 CTGGGGACACAGAGTGGTGAGGG - Intronic
1151562445 17:74877935-74877957 CAGGGGGCACAGAGAGAACAGGG - Exonic
1151702872 17:75752639-75752661 CTGGGTCCAGAGAGGGCAAAGGG + Intronic
1152026433 17:77812384-77812406 CTGGGCCCTCTGTGGGAAGATGG + Intergenic
1152293224 17:79452618-79452640 ATGGGGTCACAGAGCGGAGAGGG + Intronic
1152347175 17:79760295-79760317 GTGGGGCGACCGAGGGCAGAGGG + Intergenic
1152430526 17:80246220-80246242 CTGCGGGCACAAGGGGAAGATGG - Intronic
1152573408 17:81130212-81130234 CTGGGAACACAGAGGCAGGAGGG - Intronic
1152905025 17:82965298-82965320 CTGGGACAACAGAGGGAGAAGGG - Intronic
1153063558 18:1019397-1019419 CTGTGGCCTCAGAGGAAATATGG + Intergenic
1153612302 18:6898879-6898901 CAGGGGCAAAAGGGGGAAGAGGG + Intronic
1155108364 18:22689254-22689276 CTGGAGGCAGAGAGGGAAGCTGG + Intergenic
1155374478 18:25140646-25140668 ATGGGGAGACAGAGGGGAGAAGG + Intronic
1156387620 18:36620174-36620196 ATGAGGCCACAGAGGCACGAAGG - Intronic
1157328079 18:46683518-46683540 CTGAGGGCAGAGAGGGAAGAAGG + Intronic
1157382545 18:47232560-47232582 CTGGGGACACAGAGGAGGGATGG - Intronic
1157766389 18:50300201-50300223 CAAGGGCCACAGAGAGTAGAAGG - Intergenic
1159548570 18:69871195-69871217 CTGGGGGCAGAGATGGCAGAGGG - Intronic
1159579427 18:70218612-70218634 CTGAGGACACAGAGAGAAGATGG - Intergenic
1159812971 18:73038997-73039019 CTGGGGCCTCTGGGAGAAGAGGG - Intergenic
1159879409 18:73844562-73844584 GTGAGGACACAGAGAGAAGATGG - Intergenic
1160663774 19:313393-313415 CAGGGGCCAGGGAGGGCAGAGGG - Intronic
1160778928 19:869212-869234 CGGGGCCCACACAGGGACGAGGG + Intronic
1161231336 19:3176531-3176553 CTGGGGGGACAGAGGGCAGGTGG + Intronic
1161616601 19:5274345-5274367 CTGGGGATACAGTGGAAAGAAGG + Intronic
1161845016 19:6707378-6707400 CAGGAGCCAGAGAGGGAGGAGGG - Intronic
1161961780 19:7527423-7527445 CTGGGGAAGCACAGGGAAGAAGG + Intronic
1162184454 19:8894195-8894217 GTGGGGCCAGGGAGGGATGATGG + Exonic
1162319000 19:9959895-9959917 GTCGGACTACAGAGGGAAGAGGG - Exonic
1162766837 19:12924865-12924887 CGGGGGCCCCAGTGGGGAGAGGG - Intronic
1162947788 19:14054278-14054300 CTGGGAACAGAGAGGGAAGGAGG - Exonic
1162966410 19:14158281-14158303 CTGGGAACACAGAGGGTACAGGG + Intronic
1163184016 19:15623780-15623802 CTGGGGCTACAGTGGGGACAGGG + Intronic
1163469376 19:17487633-17487655 CTGGGGACAGAGAGGGCAGCTGG + Intronic
1163627978 19:18401859-18401881 CTGAGGACACAGTGAGAAGACGG - Intergenic
1163989256 19:20983139-20983161 CTGTGGACACAGAGTAAAGAAGG - Intergenic
1164559205 19:29277076-29277098 AGGGGGCCACAGGGGGAAGAGGG + Intergenic
1164659523 19:29950260-29950282 CTGGGGGGAAAGGGGGAAGAAGG + Intronic
1164727515 19:30476184-30476206 CTGGGGCCACAGAGGGAAGAAGG - Intronic
1165141747 19:33704000-33704022 CTGGGGTCCCAGAGGGAAGTCGG + Intronic
1165279890 19:34786813-34786835 CTAGGGCCTCAGAGGCAGGAAGG - Intergenic
1165339522 19:35200788-35200810 CTGTGACCACAGAGGGCAGGAGG - Intergenic
1165357227 19:35311733-35311755 CAGGGGCCACAGAGGTGGGAAGG + Intronic
1165412877 19:35673209-35673231 CTGGGGAGACAGAGGGAGGACGG - Intronic
1165486764 19:36101180-36101202 GTGGGGGCAGAGAGGGAACAAGG - Intronic
1165539805 19:36483435-36483457 CTGAGCCCAGAGATGGAAGAGGG + Intronic
1165793913 19:38507527-38507549 GTGGGGCCAGAGAGGGGAGAAGG + Intronic
1165843262 19:38802158-38802180 CTGGGGACAGAGAGGGATGGGGG + Intronic
1165894893 19:39135790-39135812 ATGGGGTCACTGTGGGAAGATGG - Intronic
1165895818 19:39140251-39140273 CTGAAGCCACAGAGGGGAGATGG + Intronic
1166179072 19:41094477-41094499 CTGGGGACACAGAGAGAGGCTGG - Intronic
1166191325 19:41178795-41178817 GAGGGGCCAAGGAGGGAAGATGG + Intergenic
1166478400 19:43149241-43149263 CTGGAGCTAGAAAGGGAAGAAGG + Intronic
1166496671 19:43307881-43307903 GTGGGGCCACAGGGAGAAGGTGG - Intergenic
1166714897 19:44960723-44960745 CTGGAGCCTCAGAGGGAAGTGGG + Intronic
1166875357 19:45893633-45893655 CTGGGGGAAGACAGGGAAGATGG + Intronic
1167300270 19:48673858-48673880 CTGGGGCCACCCAGGGCAGCAGG - Intergenic
1167577491 19:50324841-50324863 GTGGTGCCACAGAGGGGAGGTGG + Intronic
1167603455 19:50467511-50467533 GTGGGGCAGCAGAGGGCAGAGGG - Intronic
1168345891 19:55650056-55650078 CTGGTGTCACAGAGGGGAGGGGG - Intronic
1168460042 19:56547209-56547231 GTGAGGACACAGAGAGAAGACGG - Intronic
1168518742 19:57031695-57031717 CGGGGGCAGCAGAGGGAGGAAGG - Intergenic
924987253 2:283400-283422 GTGGGGCAGCGGAGGGAAGAGGG + Intronic
925338294 2:3114818-3114840 CCAGGGCCACAGAGGGATCAAGG - Intergenic
925359577 2:3268104-3268126 GTGGGGTCACAGAGGGACCAAGG - Intronic
925865447 2:8222610-8222632 GTGGGGCCACAGGGAGAAGGTGG - Intergenic
926147010 2:10402565-10402587 CTGGGGCCACCGAGGGCGGCTGG + Intronic
926269352 2:11353539-11353561 CTGAGGCCACAGAGGTAAAAAGG - Intergenic
926369839 2:12168663-12168685 CAGGGGGCCCAGAGAGAAGAAGG + Intergenic
927039695 2:19215983-19216005 CTGTGACCACAAATGGAAGAAGG - Intergenic
927195366 2:20542844-20542866 CTGGGGGCACAGATGGGAGGTGG + Intergenic
927680185 2:25133770-25133792 CAGGGGACACAGAGGGGAAAAGG - Intronic
928188869 2:29143087-29143109 CTGAGGTCACAGAGCCAAGAGGG + Intronic
929600214 2:43199985-43200007 CTGGAGCCAGGGAGGGAGGACGG - Intergenic
929688154 2:44052237-44052259 ATGGGGCCACAGGGGGAACAGGG + Intergenic
929775721 2:44929544-44929566 CTGGGGTCACCGAGGGGTGACGG - Intergenic
929834478 2:45382489-45382511 ATGGGGTAACAGAGGGAGGAAGG - Intergenic
930265980 2:49199542-49199564 CAGGGGACACAGAGGGACAATGG - Intergenic
930627615 2:53716197-53716219 CTGGGGTCAGAGAGGTAACATGG + Intronic
931392310 2:61854533-61854555 CGGGGGCCAGAGTGGGAAGGAGG + Intergenic
931464845 2:62477015-62477037 CTGGGGAGAGAGAGGGAAGGAGG + Intergenic
932226942 2:70048904-70048926 AGAGGGACACAGAGGGAAGATGG - Intergenic
932421602 2:71604523-71604545 CAGGGGGCAGTGAGGGAAGATGG + Intronic
932605452 2:73162868-73162890 GTGGGGCCAGAGAGGGAAGAAGG + Intergenic
933776177 2:85772469-85772491 CTGGCGCCACGGAGGGCAGAGGG + Intronic
933895783 2:86808648-86808670 CTGGGCCCCCAGATGGAAGACGG - Intergenic
934069947 2:88374563-88374585 CTGGGGCAAGAGAGGGAAATGGG + Intergenic
934657245 2:96122767-96122789 CTGGGGCCCCAGAGGGCAAGGGG + Intergenic
934762801 2:96865633-96865655 CTGGGGACACCGAGGTAGGAGGG + Intronic
935552698 2:104475227-104475249 CTGTGGGGACAGAGGGAATATGG - Intergenic
935673779 2:105576894-105576916 CTGAGGCCAGTGAGGAAAGAAGG + Intergenic
936072787 2:109382518-109382540 CTGGGGACACAGCTGCAAGACGG - Intronic
936077734 2:109412350-109412372 CTGGGGCCACACTGGGAGGGTGG - Intronic
936400333 2:112159948-112159970 GGGGGGCCACAGTTGGAAGATGG - Intronic
936616734 2:114055740-114055762 CTGAGGACACAGGGAGAAGATGG + Intergenic
937227680 2:120379092-120379114 GTGGGGGCACAGTGGGGAGAAGG - Intergenic
937243897 2:120479973-120479995 CTGGGACCACAGAGGGACTTGGG - Intergenic
937317383 2:120940607-120940629 CTGGGGTCACAGAGAGAGAATGG - Intronic
937376667 2:121341128-121341150 CTAGGGCCACAGAGGGAGGGAGG + Intronic
937976815 2:127587487-127587509 ATGAGGACACAGAGAGAAGACGG - Intronic
938050161 2:128162625-128162647 CAGGAGCCACTGAGGTAAGAGGG - Intronic
938059159 2:128238731-128238753 GTGCGGACACAGCGGGAAGATGG - Intronic
938101421 2:128500330-128500352 CTCAGTCCACACAGGGAAGAGGG + Intergenic
938320035 2:130356374-130356396 CGGGGGGCAGAGAGTGAAGACGG - Intronic
939358180 2:141131982-141132004 CTGGGGCAAGAGTGGGAAGGGGG - Intronic
939475532 2:142681535-142681557 CTAGAGGCACAGAGGGACGAAGG + Intergenic
940839387 2:158561631-158561653 CTGGGGCCACAGAGCAGAGGTGG - Intronic
941408310 2:165120041-165120063 GTGGGTCTACAGAGGGATGATGG + Intronic
942450251 2:176104710-176104732 CTGGGGCCAAAGAGCCAAGCGGG + Intronic
942814945 2:180042032-180042054 CTGGGTCCTCACATGGAAGAAGG - Intergenic
943790621 2:191928312-191928334 CTGTGGCTACAGAAGGAAGTTGG - Intergenic
944137441 2:196414662-196414684 CAGGGGCCTCAGAGGCCAGATGG - Intronic
944196420 2:197059121-197059143 CTAGGGCCAGAGAGAGTAGAGGG + Intronic
945511735 2:210711685-210711707 CTGGGGCCACTGGGAGAAAATGG - Intergenic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
946372973 2:219291629-219291651 CCCGGGGCAGAGAGGGAAGATGG + Intronic
946975808 2:225148907-225148929 ATGGGGTCAGAGGGGGAAGAGGG - Intergenic
947600745 2:231448294-231448316 CTGGAGCAACCCAGGGAAGATGG - Intergenic
947750341 2:232528798-232528820 CTGGGGCCACAGAGTGGGGAAGG - Intronic
948138787 2:235657922-235657944 GTGAGGACACAGGGGGAAGACGG + Intronic
948150156 2:235738461-235738483 CTGGGGCCACACACAGAACAGGG + Intronic
948545820 2:238727981-238728003 TGGGGGTCACAGAGGGAAGCTGG + Intergenic
948786925 2:240357485-240357507 CTGGGGACACCGAGCGGAGAAGG + Intergenic
1168850497 20:973345-973367 CTGGGGACACTGAGGCCAGAAGG + Intronic
1169132352 20:3172897-3172919 CTTAGGCCACCGAGGGAAGACGG - Intronic
1169193709 20:3672627-3672649 CTGGGACCAGAAAGGCAAGAAGG + Intronic
1169248266 20:4041230-4041252 CTGGGTCCAGAGTGGGATGATGG - Intergenic
1170926352 20:20727944-20727966 CTGGAAGGACAGAGGGAAGAGGG + Intergenic
1171190275 20:23154036-23154058 GTGAGGACACAGAGAGAAGATGG - Intergenic
1172042046 20:32052587-32052609 CTGGGGGCAGCGAGGGGAGACGG + Intronic
1172133686 20:32673230-32673252 CTGGAGCCACAGAGGCAGGAGGG + Intergenic
1172162020 20:32875403-32875425 CAGGGGGCACAGAAGGGAGATGG - Intronic
1172185408 20:33028290-33028312 CTGGGGCCACTGAGGCCAGAGGG - Intergenic
1172330593 20:34073796-34073818 CTGGGGAAACAAAGGGGAGAGGG - Intronic
1172479189 20:35260918-35260940 CTGGGGCCAGAGTGGGCAGTAGG + Intronic
1172771384 20:37384438-37384460 CTGGGGCCACGGCGGGGAGGCGG + Intronic
1172892683 20:38278191-38278213 GTGGGGCCATAGAGGGAAAGGGG - Intronic
1172984843 20:38976758-38976780 TAGGGGCTGCAGAGGGAAGAGGG - Intronic
1173251660 20:41366837-41366859 CTGGGGCCGCGGAGGGGAGGCGG + Intergenic
1173718125 20:45229457-45229479 CTGGATACACAGTGGGAAGAGGG + Intergenic
1173730480 20:45325127-45325149 GTGGGGGCAGAGAGGTAAGAAGG - Intergenic
1173809565 20:45947817-45947839 CTGGGGCCTCAGAGGGACCCCGG + Exonic
1173812273 20:45963390-45963412 CTGGTGCCACTGAGGGAGAATGG - Intronic
1173862659 20:46294399-46294421 CTGGGGCCTCAGACAGGAGATGG + Intronic
1173866667 20:46316920-46316942 CTGAGGCCACAGATGGGACAAGG + Intergenic
1173904190 20:46613822-46613844 CTGGGGGCAGAGGGGGAAGGAGG + Intronic
1174102359 20:48137407-48137429 CTGGGACCACAGAGGAAGGAGGG - Intergenic
1174492787 20:50913763-50913785 CTTGGCCTACAGAGGGAAGCTGG + Intronic
1175156106 20:56972754-56972776 TTGGGGCCCCAGAAGGCAGAGGG + Intergenic
1175247177 20:57589203-57589225 CTGAGGCCACACAGGGAGGCAGG + Intergenic
1175248918 20:57597280-57597302 CTGGGGCCACAGCTGGAAGCCGG + Intergenic
1175272257 20:57742558-57742580 CTGGGGCCACTGGAGGAAGGAGG + Intergenic
1175516874 20:59575688-59575710 CTGGGTCCACAGAGTGGGGAAGG + Intergenic
1175522597 20:59611698-59611720 CTGGGGCCGGAGAGGGAGGCAGG - Intronic
1175751266 20:61499579-61499601 CTGAGGTCACACAGGGAGGAGGG + Intronic
1175902123 20:62364072-62364094 CTGGGGACACAGCGGGAATAAGG - Intronic
1176053802 20:63134462-63134484 TGGGGCCCACAGAGGGAAGCAGG + Intergenic
1176075093 20:63244735-63244757 CCAGGGCCACTGAGGGAAAAAGG + Intronic
1176905533 21:14496039-14496061 AGGGGCCCACAGAGGGAAGATGG - Intronic
1176957605 21:15124190-15124212 CTGGGTAAACAGAGGTAAGACGG + Intergenic
1177107004 21:16969332-16969354 CTGGGGGCACTGGGGGCAGAGGG + Intergenic
1178288646 21:31347321-31347343 CTTGGGCCTCGGAGGGAAGCAGG + Intronic
1178821528 21:35979504-35979526 CTGGGTCCTCACAGGGCAGAAGG - Intronic
1179167168 21:38944242-38944264 CTGGAGTCACAGAGGGCAGTGGG - Intergenic
1180187075 21:46145340-46145362 CTGGGGCCCCAGTGAGAAGCGGG - Intronic
1180500369 22:15924227-15924249 GTGGGGCCTCAGGAGGAAGAGGG - Intergenic
1180818828 22:18810886-18810908 GTGGGGCCACAGAGAGAAAGGGG + Intergenic
1180874835 22:19170309-19170331 CAGGGACCCCAAAGGGAAGATGG - Intergenic
1180958853 22:19753673-19753695 CTGGGGCCACAGAAGGGAAGGGG + Intergenic
1181033769 22:20160320-20160342 CTGAGGCCAGAGAGGGCTGAAGG - Intergenic
1181039057 22:20183438-20183460 CCAGGGCCACACAGGGCAGACGG - Intergenic
1181042356 22:20198137-20198159 CTGAGGCCAGAGCGGGGAGATGG - Intergenic
1181173321 22:21022502-21022524 GTGGGGCCACACAGGAAAGCTGG - Intronic
1181205052 22:21245341-21245363 GTGGGGCCACAGAGAGAAAGGGG + Intergenic
1181535075 22:23537620-23537642 CTGGGGACCCAGAGAGAAGGAGG + Intergenic
1181654653 22:24287021-24287043 CTGTGGCCAGAAAGGTAAGAGGG + Intronic
1181701256 22:24622769-24622791 CTGTGGCCACAGATGAGAGAAGG + Intronic
1181759894 22:25051077-25051099 CAGGGGCCTCAGAGGCCAGAAGG - Intronic
1181790612 22:25262891-25262913 CTGGGGCCCCAGAGGAGTGAGGG + Intergenic
1181996083 22:26883842-26883864 CAGGGGCCAGAGAGGGGAGGCGG - Intergenic
1182003595 22:26940889-26940911 GTGGGGGCACAGAGGGAGGGAGG + Intergenic
1182058393 22:27379098-27379120 CTGGTGCCACAGAGGAGAGCAGG + Intergenic
1182485205 22:30635198-30635220 CTGGGGCTACGGAGGGGCGATGG + Intergenic
1182557357 22:31136527-31136549 CTGGGGCAGCAGGGGGTAGAGGG + Intronic
1182675726 22:32037816-32037838 TTGGGGACACAGGGGAAAGACGG + Intergenic
1182779726 22:32858146-32858168 CTGGGGTCACTGGGGGAAGGAGG + Intronic
1183237425 22:36630121-36630143 ATGTGGCCACAGAGGTAAGCAGG + Intronic
1183338287 22:37263612-37263634 GTGGGGACACAGGGAGAAGACGG + Intergenic
1183522035 22:38301020-38301042 CTGGGGCCACAGAGGTGGAAAGG + Intronic
1183948347 22:41339227-41339249 ATGGGGACACAGCGGGGAGAGGG - Intronic
1184044707 22:41965647-41965669 CCTGGGTCCCAGAGGGAAGAGGG + Intergenic
1184368777 22:44069351-44069373 CTGCGGCCCCAGAGGGATGAGGG + Intronic
1184385678 22:44173149-44173171 CTGGGACCACAAGGAGAAGAGGG + Intronic
1184531124 22:45056347-45056369 CTTGGGCCAGACAGGGCAGATGG - Intergenic
1184711094 22:46250015-46250037 CTGGGGCGAGAGAGGGCAGGCGG - Intronic
1184869011 22:47221819-47221841 AGAGGGCCACACAGGGAAGAAGG + Intergenic
1185051669 22:48557325-48557347 GTGAGGACACAGAGAGAAGACGG + Intronic
1203221873 22_KI270731v1_random:50074-50096 GTGGGGCCACAGAGAGAAAGGGG - Intergenic
949539298 3:5019939-5019961 CTGTGGCCAGAGAGGAAAGGGGG - Intergenic
949694646 3:6680662-6680684 CTGTGGCCAGAGAGAGAAAATGG + Intergenic
949918923 3:8986247-8986269 CTGGGGGCTCAGAGGGATGAGGG - Intronic
950030260 3:9847328-9847350 ATGTGACCACAGTGGGAAGATGG + Intronic
950118559 3:10467009-10467031 CTGAGGCCAAAAAGAGAAGAAGG - Intronic
950215373 3:11154764-11154786 CTGAGGCCACAGTGTGGAGAGGG - Intronic
950426557 3:12927630-12927652 CTCAGAGCACAGAGGGAAGAGGG + Intronic
950451623 3:13068663-13068685 ATTGGGCCACAGAGGGAGGATGG - Intronic
950479671 3:13236668-13236690 CTGGGTCCACAGACGTGAGAAGG + Intergenic
950542067 3:13618696-13618718 CTGGGGGCAGAGGGGGTAGAAGG - Intronic
951724609 3:25743312-25743334 TTGAGGTCAGAGAGGGAAGAGGG - Intronic
951906833 3:27714824-27714846 CTCGGGCCCCAGAGGGACGGAGG + Intergenic
952849144 3:37713475-37713497 ATTGAGCCACAGAGGGAGGAGGG + Intronic
952859948 3:37804629-37804651 CTGGGGACACAGTGGAAACAAGG - Intronic
953184001 3:40621317-40621339 CTTGGGCAGCAGTGGGAAGAGGG + Intergenic
953575135 3:44107217-44107239 CCTGGGCCACAGAGGCCAGAGGG + Intergenic
953707798 3:45244365-45244387 TGGGGGCCACAGGGGCAAGAGGG + Intergenic
954459891 3:50620320-50620342 CTGGGGCAACTGCGGGGAGAGGG - Intronic
954900498 3:54015012-54015034 CTGGAGCCACAGCTGGAAGGTGG + Intergenic
954914328 3:54135927-54135949 TTGAGGCCACAGATGGAAGAAGG + Intronic
955182223 3:56683114-56683136 CTGAGGCCACGGGGGGAAGGGGG - Intronic
955387435 3:58491349-58491371 CCGGGGCCACCGGGGCAAGACGG - Intergenic
956651582 3:71509347-71509369 GTGATGACACAGAGGGAAGATGG - Intronic
957072467 3:75577815-75577837 CTTGGTCCACAGAGGGAAATGGG - Intergenic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961664922 3:128488986-128489008 CTCGGGCCCAACAGGGAAGAGGG - Intronic
961810354 3:129518462-129518484 CAGGGGCCACACTGGGAGGAGGG + Intronic
962387541 3:134944120-134944142 CTGGGGCCATAGAGGGAAATGGG - Intronic
962602987 3:137009370-137009392 CTGGGGCCACTGAAAGAAGATGG + Intronic
962832731 3:139158573-139158595 CTGGGGGCACAGGGGGAGAAGGG + Intronic
962875854 3:139535632-139535654 CTGGGGTCGCAGAGGCAACAAGG - Intronic
963052900 3:141157789-141157811 CTGAGCCAACAGAGGGCAGAAGG + Intergenic
963067002 3:141271928-141271950 CTGTCGCCACAGAAGGAAGTGGG + Intronic
964618033 3:158690848-158690870 CTGGGGCTACAGAGCGGAGTGGG + Intronic
964791847 3:160460350-160460372 CTGGGGCCATAAATGGCAGAAGG - Intronic
964873738 3:161342287-161342309 CTGGCTCCAAAGAGGGAAAAAGG - Intergenic
965682479 3:171265746-171265768 CTGGGGAAACAGAGGGAAAGTGG + Intronic
966252532 3:177882571-177882593 ATGGGACCAGAGAGGAAAGATGG + Intergenic
966311749 3:178601837-178601859 CTGGGGCCACAAAGGAACAAAGG + Intronic
966774660 3:183533379-183533401 CTGGGGAGCCTGAGGGAAGAGGG - Intronic
966923264 3:184628417-184628439 CAGGGGCCACAGAGAGCTGATGG + Intronic
967169837 3:186814415-186814437 CTAGGGCAGCTGAGGGAAGAAGG - Intergenic
967930995 3:194690000-194690022 CTGGAACCATAGAGGAAAGAGGG + Intergenic
968036583 3:195553055-195553077 CTGGAGTCTCAGAGGGAGGATGG - Intergenic
968646536 4:1743962-1743984 CTGGGGGCACTGCAGGAAGAAGG + Intronic
968817245 4:2828443-2828465 CTGGGACCCCAGAGGGAAGGAGG - Intronic
969566523 4:7982011-7982033 CTGGGGCCAGAGAGGGGAGAAGG - Intronic
969737891 4:9003219-9003241 CTTGGTCCACAGAGGGAAATGGG + Intergenic
970194367 4:13541033-13541055 CTGGAGTCGCAGAGGGCAGAAGG + Exonic
970640195 4:18055701-18055723 CTGGGAACACAGGGGCAAGATGG + Intergenic
971424326 4:26501343-26501365 GTGAGGCCACAGAGGGAGGCAGG - Intergenic
973173037 4:47168904-47168926 GTGGAGACACAGGGGGAAGATGG - Intronic
974466059 4:62258087-62258109 CTGGAGACACAGAGAGAAAATGG - Intergenic
975323600 4:73035915-73035937 CAGAGGACACACAGGGAAGAAGG - Intergenic
975329358 4:73097138-73097160 CGTGGGCAAAAGAGGGAAGAAGG - Exonic
976837010 4:89386116-89386138 ATGGAGGGACAGAGGGAAGAAGG + Intergenic
977049303 4:92106888-92106910 CTGGGGGCACAGAGGCAGGGTGG + Intergenic
980770967 4:137372730-137372752 CTGAGGCCACACAGATAAGAAGG - Intergenic
981545144 4:145885947-145885969 CTGGGGCAGCAAAGGGAAGGAGG - Exonic
981669437 4:147270465-147270487 TTGGGGACTAAGAGGGAAGAGGG - Intergenic
981913420 4:150008504-150008526 CTGGAGCCACAGAGGTGAGGCGG + Intergenic
981943372 4:150311540-150311562 CTGGGGACACAGAGGACTGATGG + Intronic
982198054 4:152936034-152936056 CGGGGGCCACCGAGAGAAGTAGG - Intergenic
983254071 4:165379039-165379061 CTGGGGCCACCCAGAGGAGACGG - Exonic
984210078 4:176836590-176836612 CTGAGGACACAGCGAGAAGATGG + Intergenic
984874502 4:184355194-184355216 CAGGGGCAACACAGCGAAGAAGG + Intergenic
985607348 5:865134-865156 CAGGGTCCACAGAGGGCACAGGG + Intronic
985770291 5:1805606-1805628 CTGGGGCCACATAAGTCAGATGG + Intronic
985851270 5:2390632-2390654 CCTGGGCCACAGGGGGAGGAAGG + Intergenic
985913301 5:2899193-2899215 CTGGGTCCACGGTGGGAAAATGG - Intergenic
985973330 5:3394184-3394206 CCAGGGCCACAGAGGCAAGATGG + Intergenic
986064920 5:4225883-4225905 CTAGGGACACAGAGAGAACACGG - Intergenic
986736005 5:10667750-10667772 CTGAGGCCCCAGAGGGAGCATGG - Intergenic
987084671 5:14457517-14457539 CTGAGCCCACAGAGAGAAGCTGG + Intronic
987301948 5:16605294-16605316 CTGGGGACCCAGGGGAAAGATGG - Intronic
987326838 5:16820076-16820098 CTGGGGCCACCTAGGGAGCAGGG + Intronic
988589685 5:32538063-32538085 GAGAAGCCACAGAGGGAAGAAGG - Intronic
988821746 5:34893298-34893320 CTAGGGCGCCTGAGGGAAGATGG + Intronic
989011644 5:36877658-36877680 ATGGGGTCACAGGGGGAAGAAGG - Intronic
991063706 5:62403983-62404005 TTGGAGTCACAGAGGGAGGAAGG + Intronic
992391888 5:76337239-76337261 CTGAAGACACAGAGAGAAGATGG - Intronic
992625015 5:78628787-78628809 TTGTGGCCATAAAGGGAAGAAGG + Intronic
992998425 5:82355421-82355443 CTTGGGCCTCAGATTGAAGAAGG + Intronic
994775130 5:104030354-104030376 CTGGGCCTATAGAGGGAAAAAGG - Intergenic
995164080 5:109016963-109016985 GTGAGGACACAGTGGGAAGAAGG + Intronic
995396898 5:111696742-111696764 GTGAGGACACAGAGAGAAGATGG - Intronic
995856778 5:116600871-116600893 CTGGGGTCCCAGAGGAAAGCTGG + Intergenic
996977503 5:129452443-129452465 TTGGGGGCAAAGAGGGAAAAGGG - Intergenic
997509159 5:134441517-134441539 TGGGGGCCTCAGAGGGAAGTCGG + Intergenic
997515958 5:134490130-134490152 CAAGGGCCACAGAGGGAAAACGG - Intergenic
998167439 5:139852198-139852220 CTGGTGCTCCCGAGGGAAGAAGG + Intronic
998172696 5:139881851-139881873 CTGGGGCTTCAGAAAGAAGAGGG - Intronic
998504482 5:142660907-142660929 CTGGAGCCAGAGAAGGAAGGAGG - Intronic
998824059 5:146083332-146083354 ATAGAGACACAGAGGGAAGACGG - Intergenic
999694680 5:154178631-154178653 CCAGTGACACAGAGGGAAGAAGG - Intronic
999797406 5:155001467-155001489 ATAGAGACACAGAGGGAAGATGG + Intergenic
999809154 5:155111567-155111589 TGGGCGCCACAGAGGCAAGATGG - Intergenic
1000817011 5:165936083-165936105 ATGGGACCCCAGAGGAAAGAAGG - Intergenic
1000821935 5:165995487-165995509 CCGGAGACACAGAGGGGAGAAGG + Intergenic
1001773866 5:174314425-174314447 CTGGGGCCACAGTGGGGAACGGG + Intergenic
1001894086 5:175363796-175363818 CTGGGGCCACAGAGCCAACCTGG - Intergenic
1002342149 5:178524263-178524285 GGGGGGCCACAGTGTGAAGAGGG - Intronic
1002359377 5:178658588-178658610 CTGTGTGCACACAGGGAAGATGG + Intergenic
1002439172 5:179255529-179255551 GTGGAGGCAGAGAGGGAAGATGG - Intronic
1002452267 5:179325770-179325792 CTGGGGCCAAAGGGGGAATGCGG - Intronic
1003214327 6:4095221-4095243 CTGTGGCCACAGAGAAAAGAGGG - Intronic
1003242120 6:4353927-4353949 GTGAGGGCAGAGAGGGAAGAAGG - Intergenic
1003502122 6:6711578-6711600 GTGGGGACACAGGGAGAAGATGG - Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003606891 6:7570457-7570479 CTGGTTCCACAGAGCCAAGATGG - Exonic
1003617737 6:7670659-7670681 GTGGGGACACAGGGAGAAGATGG - Intergenic
1003882216 6:10489172-10489194 GTGGGGACACAGGGAGAAGATGG - Intergenic
1004475602 6:15968322-15968344 CTGGGGCTGCAGAAGGAAGATGG + Intergenic
1006054063 6:31367524-31367546 CTGGGTGCTCAGAGGGAAGATGG + Intergenic
1006296521 6:33172351-33172373 CTGGGGCCCCAGGGGGACCAGGG + Exonic
1006375753 6:33670916-33670938 CTGGGGACACAGAAGGAAGTGGG - Intronic
1006780859 6:36631511-36631533 CTGGCTCCAGGGAGGGAAGATGG - Intergenic
1006845245 6:37056978-37057000 CTGGGGCTACAGAGTGAACCAGG + Intergenic
1006889932 6:37418124-37418146 CATGGCCCACAGAGAGAAGATGG - Intergenic
1006909079 6:37552367-37552389 CAGGGCCCACGGAGGGTAGAGGG + Intergenic
1007250366 6:40491002-40491024 CTGTGGCCATAGAGGGGTGAGGG + Intronic
1007324799 6:41051772-41051794 CTGAGGCCAGAGAGAGATGATGG - Intronic
1007415600 6:41689494-41689516 ATGGGGCTTCAGAGGGGAGAAGG - Intronic
1007573096 6:42907443-42907465 CTGGGGCCCAAGAGGGATGGGGG - Intergenic
1008418322 6:51268709-51268731 CTGGAGGAACAGGGGGAAGAGGG - Intergenic
1008692964 6:54001752-54001774 CTGGGGCCACAGTGGTCAGCAGG - Intronic
1008750305 6:54725139-54725161 CTGAGGCCAGTGGGGGAAGAAGG + Intergenic
1009413799 6:63394952-63394974 CAGTGCACACAGAGGGAAGAAGG - Intergenic
1010651857 6:78464990-78465012 GTAGGGACACAGAGGGAAAAAGG - Intergenic
1011043546 6:83057380-83057402 CTGGGGATACAGAGTGAACAAGG - Intronic
1011598711 6:89040519-89040541 ATGGTGACACAGAGGTAAGAAGG - Intergenic
1012067090 6:94561430-94561452 CTGAGGCCACAGAGGTAGGAAGG - Intergenic
1012276793 6:97283533-97283555 CTGGCCCCAGAGCGGGAAGAGGG - Intergenic
1012957724 6:105589200-105589222 CTGGGGAAAATGAGGGAAGAAGG + Intergenic
1013805234 6:113989405-113989427 GTGAGGACACAGAGAGAAGAGGG - Intronic
1013911655 6:115282680-115282702 CTGAGGCCCCAGAGGGAGGGTGG - Intergenic
1014545852 6:122734467-122734489 GTGTGGTGACAGAGGGAAGATGG + Intergenic
1014688636 6:124533870-124533892 GTGAGGACACAGAGGGAAGATGG - Intronic
1015330889 6:131977890-131977912 CTGGGGGCTCAGAAGGAAGAGGG - Intergenic
1015352668 6:132241194-132241216 CAGGGGCCTCAGTTGGAAGACGG + Intergenic
1016382293 6:143497380-143497402 TGGGGGCAACAGAGGTAAGAGGG - Exonic
1016409339 6:143765571-143765593 CTGGAGCCACAGGGGGTGGAGGG - Exonic
1017764282 6:157593847-157593869 CTCCAGCCACAGAGAGAAGAGGG - Intronic
1018596102 6:165482344-165482366 CTGGGGATAGAGAAGGAAGAGGG + Intronic
1019026362 6:168967454-168967476 CTGGGGCCACAGTGGGGAAGTGG - Intergenic
1019430767 7:997908-997930 CTCGGGCCGCAGTGGGAGGACGG - Intronic
1019558349 7:1643576-1643598 CTGGGGACTCAGAGGGAATGGGG + Intergenic
1019983303 7:4637657-4637679 TTGGTGCCACTGAGGGAAGGGGG + Intergenic
1020138000 7:5597127-5597149 CTTCGGCCAAGGAGGGAAGATGG + Intronic
1020188493 7:5976365-5976387 CTCGGGACACAGAGGTAACAAGG - Intronic
1020294422 7:6748405-6748427 CTCGGGACACAGAGGTAACAAGG + Intergenic
1020828469 7:13062932-13062954 CTGGGGCAACAGAGATGAGAAGG - Intergenic
1022411355 7:30141004-30141026 CTGTGGTCACACAGGGAACAAGG - Intronic
1022474098 7:30699255-30699277 CAGGGGCCACCGATGGAAGGTGG - Intronic
1022539960 7:31126170-31126192 GTGAGGACACAGAGAGAAGACGG + Intergenic
1022673702 7:32478914-32478936 CTGAGGCCTCAGTGGGGAGAAGG - Intergenic
1022863985 7:34398385-34398407 GTGAGGACACAGAGAGAAGATGG - Intergenic
1023498641 7:40825042-40825064 CTGGGACCACATAGTGAAGATGG - Intronic
1023828963 7:44028329-44028351 CTGGGGTCAGAGGGGGAAGGAGG + Intergenic
1024047085 7:45592309-45592331 GTGAGGGCACAGAGGGAAGGCGG - Intronic
1024480833 7:49860849-49860871 GTGAGGCCACAGAAGGAAGGTGG + Intronic
1024863499 7:53874939-53874961 CTGGGGACTCAGAGGCAGGAAGG + Intergenic
1024868083 7:53926821-53926843 CTGGTCCCACAGTGGGAAAATGG + Intergenic
1026289083 7:68989791-68989813 ATGGAGACACAGATGGAAGAAGG - Intergenic
1026955235 7:74372634-74372656 CAGGGGCCAGCGAGGGAGGATGG + Intronic
1027152668 7:75743688-75743710 CTGGGTCCAGAGAGTGACGAGGG - Intergenic
1027485574 7:78757425-78757447 CAGGAGCCAGAGAGGAAAGAGGG - Intronic
1028052859 7:86207108-86207130 CTGGGGCAACTGAGGGTAGCTGG - Intergenic
1028354058 7:89885316-89885338 GTGGGGACACTGAGGGTAGATGG - Intergenic
1029374317 7:100168665-100168687 CTGGCGGCACAAAGGGAGGAGGG - Exonic
1029375442 7:100174460-100174482 ATGGGTCCACAGAGGGGAGGAGG + Intronic
1029481575 7:100816669-100816691 CTGGGGGTACAGAGTGAAGCAGG + Intronic
1029489203 7:100861278-100861300 CTGTGTCCCCAGAGAGAAGAAGG + Intronic
1029739262 7:102482586-102482608 CTGGGGTCAGAGGGGGAAGGAGG + Intronic
1029757263 7:102581765-102581787 CTGGGGTCAGAGGGGGAAGGAGG + Exonic
1029775203 7:102680826-102680848 CTGGGGTCAGAGGGGGAAGGAGG + Intergenic
1029919043 7:104242859-104242881 CAGTGGCCACAGAGGAGAGAAGG + Intergenic
1032383628 7:131506835-131506857 CTGGGGCTAGAGAGGGAGGCAGG - Intronic
1033259381 7:139829372-139829394 CTGGGGTCTCAGAGGAATGATGG + Exonic
1033560541 7:142526554-142526576 CTGGTGCTACAGAGCTAAGATGG + Intergenic
1033648668 7:143323599-143323621 GTGGGGCCACAGGTGAAAGAGGG - Intronic
1033653896 7:143361267-143361289 CTGGGGGAAAAGAGGAAAGATGG + Intronic
1033735438 7:144217367-144217389 CTAGGGCCACAGAGACAACAGGG - Intergenic
1033747616 7:144333602-144333624 CTAGGGCCACAGAGACAACAGGG + Intergenic
1034256526 7:149727759-149727781 CTGGGGCAACAGAGGGAGCCGGG - Intronic
1034324780 7:150220520-150220542 CTGGGACCCCGGAGGGAAGCCGG + Intergenic
1034391145 7:150788549-150788571 CTGAGGACACAGGGAGAAGACGG - Intergenic
1034422412 7:150996580-150996602 CTGGGGCCTCAGTGGGACAAGGG - Intronic
1034435140 7:151059792-151059814 CCAGGGCCGCAGAGGGAGGAAGG + Intronic
1034535041 7:151721079-151721101 GAGGGGACACAGAGGGCAGAGGG + Intronic
1034674498 7:152882838-152882860 ATGGGCACACAGAGGCAAGACGG - Intergenic
1034768411 7:153748711-153748733 CTGGGACCCCGGAGGGAAGCCGG - Intergenic
1034827067 7:154275292-154275314 GAGGGGACACAGAGGGAAGGAGG - Intronic
1034855212 7:154539184-154539206 CAGGGCCCACAGTGGGGAGAAGG - Intronic
1034969785 7:155411640-155411662 CTGGAGCCACAGAGCGACCAAGG + Intergenic
1036010544 8:4717075-4717097 CTCGGGGCAGAGAGGGAAGAAGG - Intronic
1036191438 8:6674306-6674328 ATGGGGCCACACAAGGGAGATGG - Intergenic
1036428910 8:8671471-8671493 CTGGGAACACAGGGGCAAGAGGG + Intergenic
1036709305 8:11068135-11068157 CTAGGGCCACAAAGAGCAGATGG - Intronic
1036930573 8:12951841-12951863 CTGCGGCCGCGGCGGGAAGAAGG + Intronic
1037949696 8:23010846-23010868 ATGAGGACACAGAGTGAAGAAGG + Intronic
1038378703 8:27070936-27070958 CTGAGGCTACAGAGGTAAAATGG + Intergenic
1038727646 8:30095558-30095580 CTGGGGCCGGCGGGGGAAGATGG + Intronic
1039045907 8:33449200-33449222 CTGTGGGCACTGAGAGAAGAAGG + Intronic
1039395548 8:37222388-37222410 CTGGGCCCACAGGGGGAACAAGG - Intergenic
1039438947 8:37581394-37581416 CTGGGGGCACAGAAGGAACATGG - Intergenic
1039635799 8:39163330-39163352 CAGGGCCCACAAAGGGAAGGAGG + Intronic
1040064454 8:43133765-43133787 CAGGGGGCAAAGAGGAAAGAGGG + Intergenic
1040304813 8:46206540-46206562 ATAGGGCCACAGGGGGAAGTGGG + Intergenic
1040342236 8:46446887-46446909 ATGGGGCCACAGGGTGATGAGGG - Intergenic
1040547043 8:48406855-48406877 CTGAGGTCAGCGAGGGAAGATGG + Intergenic
1041527521 8:58823798-58823820 CTAGGGGCGAAGAGGGAAGAAGG + Intronic
1042335738 8:67628532-67628554 CAGTGGCTACAAAGGGAAGATGG - Intronic
1042765416 8:72315850-72315872 CAGGAGACAGAGAGGGAAGAGGG + Intergenic
1043500030 8:80844352-80844374 CTGAGGCCATAGCGAGAAGATGG - Intronic
1044627190 8:94245578-94245600 GAGGGGACACAGAGGGAAGAAGG - Intergenic
1045031219 8:98138288-98138310 ATGAGGCCTCAGAGGCAAGAAGG - Intronic
1045054901 8:98360381-98360403 ATGGAGACACAGAGGGAAGAAGG - Intergenic
1047211252 8:122842266-122842288 CTGGGGGCCCTGAGAGAAGAAGG - Intronic
1047309947 8:123683539-123683561 ATGGGGCCACAGACAGAAGGTGG - Intronic
1047363481 8:124191084-124191106 CTTGGGCTACAGAGGAAAGGTGG + Intergenic
1047694901 8:127393750-127393772 TTGGGCCCACTGAGAGAAGATGG + Intergenic
1048043007 8:130748960-130748982 CTGGGGCAAGAGAGGGAGAAGGG + Intergenic
1048210401 8:132449939-132449961 CTCTGGACACAGTGGGAAGAGGG - Intronic
1048285812 8:133140821-133140843 ATGAGGCCAAAGAGGGAAGAAGG - Intergenic
1048382775 8:133882685-133882707 CAAGGGGCACACAGGGAAGAAGG - Intergenic
1048509631 8:135050519-135050541 CTCAGGCCACAAAGGTAAGAAGG - Intergenic
1048936921 8:139365141-139365163 GTGAGGACACAGAGAGAAGACGG - Intergenic
1048968304 8:139629728-139629750 CTGGGGACACAGCAGGAAGGTGG - Intronic
1049257465 8:141621551-141621573 CTGAGGCCACCGAGGGGTGAGGG - Intergenic
1049427976 8:142545721-142545743 CTGGAGACACAGAGGGAAGCAGG - Intergenic
1049592037 8:143466961-143466983 CTAAGGCCAAGGAGGGAAGAAGG + Intronic
1049592062 8:143467086-143467108 CTGCAGCCGCAGAGGGGAGAGGG + Intronic
1049609900 8:143550069-143550091 TTGCGGACCCAGAGGGAAGAAGG - Intergenic
1049747506 8:144269231-144269253 CAGTGGGCACAGAGAGAAGAAGG + Intronic
1049808192 8:144550838-144550860 CTGGGGACACTGAGGGGTGAAGG + Intronic
1050446581 9:5729027-5729049 CTGGAGACAGAGAGGGGAGAGGG - Intronic
1050636041 9:7614256-7614278 CTGGAGCCATAGTGGGAAGAGGG - Intergenic
1051347420 9:16164786-16164808 CTGGGGGCTCTGAGGGAAGGAGG - Intergenic
1052173012 9:25425516-25425538 CAGAGGCCCCAGAGGAAAGAAGG + Intergenic
1052265542 9:26567795-26567817 CTGGGGCCTGAGAGGGAGGGAGG - Intergenic
1052977388 9:34421292-34421314 CTGGGGGTACAGAGGTAAGGAGG + Intronic
1053018157 9:34675837-34675859 CTGGGGTGTCAGAGGGAAGTAGG + Intergenic
1053887370 9:42654192-42654214 CTGGGACCACACAGGACAGAAGG + Intergenic
1054226392 9:62461643-62461665 CTGGGACCACACAGGACAGAAGG + Intergenic
1054768866 9:69066546-69066568 CTGAGGCCACAGAGGCTAGTTGG - Intronic
1055845238 9:80554636-80554658 TTGTGGTCACAGAGAGAAGATGG + Intergenic
1056131014 9:83586514-83586536 CTCAGGCCACAGAGGCAGGAAGG + Intergenic
1056408800 9:86303970-86303992 CTGGGAGTACAGAGGGAATAGGG + Intronic
1057294983 9:93829669-93829691 CTGGGGCCAGAGAGAAAAGAGGG - Intergenic
1058385063 9:104426698-104426720 AGGGGACCAAAGAGGGAAGACGG + Intergenic
1058938476 9:109791414-109791436 CTGGGTCCACAGAGAAAAGCAGG + Intronic
1059119201 9:111627006-111627028 CTGGGGCCTCTGAGGGAGGAGGG + Intergenic
1059342260 9:113604119-113604141 CTGGGGATACAGTGAGAAGACGG - Intergenic
1059456254 9:114402178-114402200 CTGGGGGTGCAGAGGGAAGCTGG + Exonic
1059529573 9:115023498-115023520 CTGAGGTCACAGAGTGAAGTTGG - Intronic
1059694862 9:116721435-116721457 ATGGAGCCCCAGTGGGAAGAAGG + Intronic
1060147820 9:121267834-121267856 CTGGGGCCAAAGAGCTCAGATGG - Intronic
1060199552 9:121644799-121644821 CTGGGGTCACACAGTGAAGAGGG + Intronic
1060494164 9:124105718-124105740 AAGGGGACACAGAGGGAAGGAGG - Intergenic
1060522149 9:124300057-124300079 CTGAGGACACAGAGGGAGAAGGG + Intronic
1060747620 9:126148092-126148114 CTGGGACCAGAGAGGAAAGTGGG + Intergenic
1060861253 9:126956582-126956604 GGTGGGCCACAGGGGGAAGATGG + Intronic
1060897135 9:127225197-127225219 CTGGGCCCAGCGAGGGGAGAGGG + Intronic
1060978205 9:127777554-127777576 CTGGGGCAGCAGAGGGATGGGGG - Intronic
1061202770 9:129147097-129147119 CTTGGCCCAGAGAGGGAAGTTGG - Intronic
1061249062 9:129415999-129416021 CTGGGGACACAGCTGGAAGATGG + Intergenic
1062005457 9:134236479-134236501 CTGGGGCCTCAGCTGGAGGAGGG + Intergenic
1062044421 9:134418466-134418488 CTGGGCCCACAGAGGGACAGAGG - Intronic
1062171517 9:135137397-135137419 CTGGGGGCAGGGAGGGAGGAAGG + Intergenic
1062249192 9:135585846-135585868 CTGGGGCCTGGGAGGGAAGATGG - Intergenic
1062278518 9:135741749-135741771 CTGAGGCCACACAGGCAGGAAGG - Intronic
1062315292 9:135964231-135964253 CTGGGGGAACAGAGAGAGGAGGG + Intergenic
1062571946 9:137189784-137189806 CTGGGGCCAGAGAAGTGAGAAGG - Intronic
1062586069 9:137250679-137250701 CTGGGGGCACAGAGGCTAGAGGG - Intergenic
1062730000 9:138103430-138103452 CTGGGGCCTCAGAGGGCTGCTGG + Intronic
1185558031 X:1036710-1036732 GTGAGGCCACAGGGAGAAGACGG + Intergenic
1185618424 X:1437473-1437495 GTGAGGACACAGGGGGAAGACGG - Intronic
1185631107 X:1516332-1516354 GTGGGGACACAGGGAGAAGACGG + Intronic
1185704736 X:2258289-2258311 GTGAGGACACAGAGAGAAGATGG + Intronic
1185734857 X:2488911-2488933 CTTGGGCAGCAGGGGGAAGAGGG + Exonic
1185770398 X:2761522-2761544 GTGGGGACACAGGGAGAAGATGG + Intronic
1185790209 X:2923600-2923622 CTGAGGACACAGGGAGAAGATGG - Intronic
1185808008 X:3078419-3078441 TGGAGGCCAAAGAGGGAAGATGG - Intronic
1186760134 X:12714381-12714403 TTTGGGCCACATAGAGAAGAGGG - Intronic
1187871738 X:23770380-23770402 CAGAGGCCACAGAGAAAAGAGGG + Intergenic
1188245479 X:27831758-27831780 CTGGGATCACAGAGAGATGAGGG + Intergenic
1189422867 X:40872143-40872165 GTGGGGCTGCAGAGAGAAGAAGG - Intergenic
1189985409 X:46549172-46549194 CTTGAGACACAGAGGGAAAAAGG - Intergenic
1190088226 X:47414821-47414843 TTGGGGCTGGAGAGGGAAGAAGG + Intergenic
1190380026 X:49829963-49829985 GTTGGGCCACGGAGGGGAGAGGG + Intronic
1191109527 X:56793926-56793948 GGGGGGCCACAGGGGGAACAGGG - Intergenic
1191955278 X:66637321-66637343 CTAGGGGCAGAGAGGGAACAAGG - Intronic
1192042534 X:67637978-67638000 CTGGGGCCAGTGAGGGGTGAGGG - Intronic
1192173692 X:68873046-68873068 CTGAGGCCCCAGAGGGAGAAAGG - Intergenic
1192194897 X:69021527-69021549 GAGGGGCCAGGGAGGGAAGATGG + Intergenic
1193359924 X:80569976-80569998 CTGGGAGCACAGAGGGGAGAGGG - Intergenic
1194083927 X:89502633-89502655 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1195704574 X:107729647-107729669 CTGGGCCGACAGAGGGAGGCAGG + Intronic
1197268058 X:124397079-124397101 CTAGGACCAGAGAGGAAAGAGGG + Intronic
1197451910 X:126629436-126629458 CTGGGGCTGCATAGAGAAGAGGG + Intergenic
1198069133 X:133130518-133130540 CTGGGGCAGGAGAGGGAGGAGGG + Intergenic
1198137837 X:133771795-133771817 CTCTGGGCAGAGAGGGAAGAAGG + Intronic
1198243076 X:134803253-134803275 CTGGGGCCACATGTGGAAGGAGG + Intronic
1200436574 Y:3158513-3158535 CTGTGTCCCCAAAGGGAAGAAGG - Intergenic
1200569002 Y:4804342-4804364 CTGAGGGGACAGAGGCAAGAAGG - Intergenic
1201284103 Y:12364337-12364359 CTGAGGACACAGGGAGAAGATGG + Intergenic
1201771785 Y:17622891-17622913 CTGGGACCATAGAGGGACCAGGG + Intergenic
1201829770 Y:18283095-18283117 CTGGGACCATAGAGGGACCAGGG - Intergenic