ID: 1164728037

View in Genome Browser
Species Human (GRCh38)
Location 19:30479949-30479971
Sequence GGTTCCAAGGGAGCCCGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 77}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164728026_1164728037 19 Left 1164728026 19:30479907-30479929 CCTGATGTCTAATGCAGGTCTCG 0: 1
1: 0
2: 1
3: 3
4: 58
Right 1164728037 19:30479949-30479971 GGTTCCAAGGGAGCCCGCGCTGG 0: 1
1: 0
2: 0
3: 6
4: 77
1164728033_1164728037 -8 Left 1164728033 19:30479934-30479956 CCAGCCTTCAGGGCTGGTTCCAA 0: 1
1: 0
2: 1
3: 20
4: 177
Right 1164728037 19:30479949-30479971 GGTTCCAAGGGAGCCCGCGCTGG 0: 1
1: 0
2: 0
3: 6
4: 77
1164728032_1164728037 -7 Left 1164728032 19:30479933-30479955 CCCAGCCTTCAGGGCTGGTTCCA 0: 1
1: 0
2: 4
3: 23
4: 368
Right 1164728037 19:30479949-30479971 GGTTCCAAGGGAGCCCGCGCTGG 0: 1
1: 0
2: 0
3: 6
4: 77
1164728031_1164728037 -6 Left 1164728031 19:30479932-30479954 CCCCAGCCTTCAGGGCTGGTTCC 0: 1
1: 0
2: 4
3: 40
4: 314
Right 1164728037 19:30479949-30479971 GGTTCCAAGGGAGCCCGCGCTGG 0: 1
1: 0
2: 0
3: 6
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164728037 Original CRISPR GGTTCCAAGGGAGCCCGCGC TGG Intronic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900321848 1:2088371-2088393 GGTTCCCAGGAAGCCCACGATGG - Intronic
900576566 1:3385475-3385497 GGCTCCAATGGAGCCCTCCCGGG - Intronic
900806864 1:4773277-4773299 GGTTCCAGGGGAGCCCTTTCTGG - Intronic
910549651 1:88461593-88461615 GGTTCCAAGGAAGCCCTGGTTGG + Intergenic
913445212 1:118943813-118943835 GGCTCCCAGGGAGCACGAGCAGG + Intronic
915367894 1:155325570-155325592 GGTTCCAAGGGAGCGGGTGCTGG - Exonic
915740689 1:158116320-158116342 GTTTCAAAGGGAGCCGGCCCAGG + Intergenic
920338350 1:205259717-205259739 AGTTCCACGGGAGCCAGGGCTGG + Intronic
922160522 1:223076457-223076479 GGTTCCAGGGAATCCAGCGCTGG - Intergenic
1068130519 10:52889928-52889950 GGTTCCGACAGAGCCCGAGCTGG + Intergenic
1072549108 10:96463690-96463712 GGTCCCAAGGGAGCTGGAGCTGG - Intronic
1073229760 10:101959168-101959190 GGCTCCAAGGGAGCCCATTCAGG + Intronic
1081488263 11:43547907-43547929 GGAGCCCAGGGAGCCCGAGCTGG - Intergenic
1084062812 11:66687090-66687112 GATGCCAAGGCAGCCAGCGCGGG - Exonic
1084274708 11:68045311-68045333 GTTTACAAGGGAGCCGGCACGGG + Intronic
1089220857 11:116870275-116870297 GGTTGCAGGGGAGCCTGCCCAGG + Intronic
1094836970 12:34326630-34326652 GCATCCCAGGGACCCCGCGCAGG + Intergenic
1096007657 12:48185283-48185305 GGTTCCAAGGGCCCCTGGGCTGG + Exonic
1096231320 12:49898343-49898365 GGTCCCCAGGGAGCCCCAGCCGG - Intronic
1103415463 12:120739533-120739555 GGTCCCCAGGGAGCCCCCGCCGG - Exonic
1104259573 12:127170507-127170529 GGAACCAAGGGAGTCCCCGCAGG - Intergenic
1107337445 13:39370193-39370215 GCGTCCAAGGGAGCCCACCCTGG - Intronic
1108855311 13:54786249-54786271 GGTTCCCTGGGAGCCCAAGCAGG - Intergenic
1113533085 13:111043583-111043605 GGGACCAAGGGAGGCCACGCAGG - Intergenic
1113659137 13:112092795-112092817 GGTCCCAGAGGAGCCCGGGCAGG - Intergenic
1119265643 14:73262065-73262087 AGGTCCAAGGGAGCCGGCCCAGG + Intronic
1122355908 14:101122738-101122760 GGGCCCAAGGGAGCCTGCGGTGG + Intergenic
1122951901 14:105049883-105049905 GGCTTCCAGGGAGGCCGCGCAGG - Exonic
1123014925 14:105369064-105369086 GGTTCCAGGGAGGCCAGCGCAGG + Intronic
1127961889 15:63896177-63896199 TGTTCCTAAGGAGCCCGAGCTGG - Intergenic
1140681095 16:77385583-77385605 AGTTCCAAGGGAGGCAGGGCAGG - Intronic
1141137339 16:81474783-81474805 GGTGCCAGGGGAGCCAGCCCAGG + Intronic
1141669467 16:85484252-85484274 GGTTCCCAGGGGACCCGCGGAGG - Intergenic
1142141404 16:88474311-88474333 GGATCCAAGGGAGCCCGAAGAGG + Intronic
1142712495 17:1730998-1731020 GGCACCAAGAGAGCCCGGGCCGG - Intronic
1147587859 17:41662946-41662968 GGTTCCAAGAGAGGCCCTGCTGG + Intergenic
1148021580 17:44557312-44557334 GGTTTCAAGGGGGCCCCCGCTGG - Intergenic
1148846492 17:50532961-50532983 GGGGCCGAGGGAGCCCGCACTGG + Exonic
1151990796 17:77572721-77572743 GGTTCTAAGGAAGCCCCTGCAGG + Intergenic
1161978750 19:7619886-7619908 GGTCCCAAGGGGGCCCGGGGTGG - Intronic
1164728037 19:30479949-30479971 GGTTCCAAGGGAGCCCGCGCTGG + Intronic
1164869494 19:31631462-31631484 GGTTCACAGGGAGCTCACGCTGG + Intergenic
925369038 2:3329876-3329898 TGATCCAAGGGAGCCCAGGCTGG - Intronic
926901197 2:17753726-17753748 GGTTCCCAGGGGGCCAGCGGCGG - Exonic
935271075 2:101435033-101435055 GGTTCACAGGGAGCCGGCGGCGG - Intronic
943646124 2:190408837-190408859 GCTGCCCAGGGAGCCCTCGCCGG + Intronic
946302348 2:218831708-218831730 GGTCCCAGGGGAGCCGGAGCCGG - Intronic
1172245787 20:33443980-33444002 GGAACCCAGTGAGCCCGCGCAGG + Intergenic
1173841287 20:46158687-46158709 GGGTCCAAGGGGGCCCGCTTCGG + Intergenic
1177871030 21:26573079-26573101 CCTTCCAAGGGAGCCCGGGCCGG + Exonic
1179547812 21:42124338-42124360 GCTTCAGAGGGAGCCCGTGCCGG + Intronic
1179555519 21:42173117-42173139 GGGTGCAAGGGAGACCACGCTGG - Intergenic
1180699714 22:17774553-17774575 GGGACCCGGGGAGCCCGCGCCGG + Intronic
1183673422 22:39286410-39286432 GGCTCCAAGGGAGCTCTGGCAGG - Intergenic
1184265900 22:43345798-43345820 GGTTCCAAGCCATCCCGTGCTGG - Intergenic
961064369 3:123862030-123862052 GATTCCAATGGAGCCCCCACGGG - Intronic
961212604 3:125137501-125137523 GGTTCCAAGGCAGGCTGGGCTGG - Intronic
963745305 3:149119142-149119164 GGAACCAAGGCAGCCCCCGCCGG + Intergenic
967820013 3:193831680-193831702 GGTTGCCAAGGAGCCCGCGTTGG - Intergenic
968707955 4:2092082-2092104 GGTGCCAAGGGAGCCAGGGGAGG - Intronic
969210791 4:5685578-5685600 GGTTCCAAGGGAGGCCACCATGG + Intronic
985666275 5:1183023-1183045 GGTGCCCAGGGAGTCCACGCTGG + Intergenic
993068910 5:83134003-83134025 GGTTCCAGGTGAGCACGGGCTGG + Intronic
1001960762 5:175879151-175879173 GGATCCAGGGGAGCCCCAGCAGG - Intronic
1004208570 6:13615162-13615184 GGCTCCAAGGCGGCCTGCGCTGG + Intergenic
1008956623 6:57222403-57222425 GCCTCCAAGGGAGCCCGGGAGGG + Intergenic
1010766114 6:79778523-79778545 GGGTCCAAAGGGGCCCTCGCTGG + Intergenic
1013117794 6:107115516-107115538 GGCTCCACGTGGGCCCGCGCTGG + Intergenic
1016182802 6:141168178-141168200 GGTTCCAAGTGAGCGCGGGCTGG + Intergenic
1019626940 7:2020586-2020608 GGTACCAGGGCAGCCCGGGCAGG - Intronic
1019709525 7:2511848-2511870 GGTTCCGGGGGAGCCCACGGCGG - Intergenic
1029570025 7:101363151-101363173 GCTGCCAGGGGAGCCGGCGCCGG - Exonic
1037273569 8:17156007-17156029 GGGTCCCTGGGAGCCCGCGGGGG - Exonic
1039401538 8:37274117-37274139 GGTACCGAGGGAGCCTGCTCTGG + Intergenic
1041712869 8:60909793-60909815 GGGGCCACGGTAGCCCGCGCGGG + Intergenic
1047961747 8:130016308-130016330 GGATCCAGGGGCGCGCGCGCGGG + Intronic
1048906305 8:139092766-139092788 GCTTACAAGGGAGCCTGCGTGGG + Intergenic
1049172606 8:141170995-141171017 AGTTGCAAGGGAGCCCGGGAAGG + Intronic
1049225261 8:141447707-141447729 GGTTTCAGGGGAGCACGCCCTGG + Intergenic
1057554655 9:96078052-96078074 GGTGCCATGGAAGCCCGCGATGG + Intergenic
1058229781 9:102411276-102411298 GGTCCAAAGGGAGCCCCTGCTGG - Intergenic
1062341238 9:136094811-136094833 GGTCCCTGGGGAGGCCGCGCGGG + Intronic
1062535439 9:137019156-137019178 GGTGCCAAGGGTGCCCGCGAGGG - Exonic