ID: 1164731532

View in Genome Browser
Species Human (GRCh38)
Location 19:30508606-30508628
Sequence GCCTCTTAGAAATTAAACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164731532_1164731534 -4 Left 1164731532 19:30508606-30508628 CCCTGGTTTAATTTCTAAGAGGC 0: 1
1: 0
2: 0
3: 22
4: 163
Right 1164731534 19:30508625-30508647 AGGCCTACAACAGAGCACCTAGG 0: 1
1: 0
2: 0
3: 6
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164731532 Original CRISPR GCCTCTTAGAAATTAAACCA GGG (reversed) Intronic
906861761 1:49368449-49368471 TCCTCATAGAAATTAATACAAGG - Intronic
908280694 1:62531989-62532011 GCCTTGTAGAAACTAAAACAGGG + Intronic
911805143 1:102197258-102197280 GTTTCTTATAAATTAAACTATGG + Intergenic
912049775 1:105512995-105513017 GCATATTAAAATTTAAACCATGG - Intergenic
912349123 1:108994636-108994658 GCCAATAAGAAATAAAACCATGG + Intronic
913977104 1:143468892-143468914 GCATTTTAGAAATTAAAACTAGG - Intergenic
914071507 1:144294519-144294541 GCATTTTAGAAATTAAAACTAGG - Intergenic
914107648 1:144671837-144671859 GCATTTTAGAAATTAAAACTAGG + Intergenic
917187407 1:172375096-172375118 TCTTCTTATAAATGAAACCACGG + Intronic
918112619 1:181470520-181470542 ACCTATTAGAAAATAAATCAAGG - Intronic
919084463 1:192905647-192905669 GCTTCTAAGAAATTCAAACAAGG + Intergenic
919980197 1:202638114-202638136 GCATCTTAGCAATTTAACAAAGG - Intronic
920168208 1:204051362-204051384 GCCTCTAAAAAAAAAAACCAGGG - Intergenic
923432152 1:233933273-233933295 GACTATTTGGAATTAAACCATGG - Intronic
923985416 1:239376470-239376492 GCCTCTTAGGAATAAAAACCTGG + Intergenic
924316601 1:242804035-242804057 GTCTCTTAGAAGAGAAACCAAGG + Intergenic
1064857588 10:19787468-19787490 GCCTCAGAGAGATTGAACCAAGG + Intronic
1065682473 10:28250974-28250996 TCCTTTTAAAAATTAAATCATGG - Intronic
1068779042 10:60899836-60899858 GCCAATTAGAAAATAAAGCAGGG + Intronic
1069583795 10:69583296-69583318 TCCTCTTAGAGATTAGACCCAGG + Intergenic
1071244598 10:83749569-83749591 GACTCTTAGAATTCCAACCATGG + Intergenic
1072125529 10:92442218-92442240 GCCTCCTATAAATTTAACCCAGG + Intergenic
1074727227 10:116324408-116324430 GCCTGTGAGAACTTAAACTACGG - Exonic
1077582539 11:3425902-3425924 GCCTTTTAGAAGTTAAGCTATGG + Intergenic
1079990737 11:27243772-27243794 GCCCCTTACTAATTAAACCAAGG - Intergenic
1080450837 11:32377602-32377624 GCCTCTGAGAGAAGAAACCAAGG + Intergenic
1084239445 11:67808726-67808748 GCCTTTTAGAAATTAAGCTATGG + Intergenic
1084832984 11:71784123-71784145 GCCTTTTAGAAATTAAGCTATGG - Intergenic
1086056763 11:82655398-82655420 GCCTTTTTTAAATAAAACCAGGG + Intergenic
1088680115 11:112233145-112233167 GCCTCCTAGAGACAAAACCAAGG - Exonic
1088891994 11:114051863-114051885 GCTTCTGACAAATGAAACCAAGG + Intergenic
1089843375 11:121438725-121438747 GGCTTTTAGAAATAAAGCCATGG + Intergenic
1091103422 11:132896832-132896854 GACTCTTAGAAATTTCACCAAGG - Intronic
1091646260 12:2274542-2274564 GCCCCTCAGAAAGCAAACCAGGG + Intronic
1092410129 12:8246348-8246370 GCCTTTTAGAAGTTAAGCTATGG + Intergenic
1093530315 12:20154083-20154105 GACTGATACAAATTAAACCATGG + Intergenic
1097507319 12:60491082-60491104 GCCTCTCAGTAAATAAATCATGG - Intergenic
1098502569 12:71210547-71210569 GCCTCTTTTATTTTAAACCATGG - Intronic
1098589153 12:72189609-72189631 GTCTCTCAGAAATTTCACCAAGG - Intronic
1099030651 12:77522378-77522400 GGCTCTTAGAAATTCAAGCAGGG - Intergenic
1101385198 12:104251164-104251186 GCCTCTCTGCATTTAAACCATGG + Intronic
1105222122 13:18340924-18340946 GCATTTTAGAAATTAAAACTAGG + Intergenic
1106841348 13:33687912-33687934 GCCACTTAGAACTTTTACCATGG + Intergenic
1108560023 13:51634024-51634046 ACCTCTTAGAAATTAATCAAAGG - Intronic
1110757606 13:79194258-79194280 GTCTCTGAGATATTAAACCTCGG + Intergenic
1111636558 13:90911870-90911892 ACCTCTTAAAATTTAAAACAAGG - Intergenic
1115504622 14:34081268-34081290 GCCTGTGAGTAATTATACCATGG - Intronic
1116725619 14:48558349-48558371 GCCTCTTTTACTTTAAACCATGG + Intergenic
1116985031 14:51209567-51209589 GCCTGTAAGCAATGAAACCAGGG + Intergenic
1118075235 14:62290944-62290966 GCCTCATATAAATTAAGCCTTGG + Intergenic
1119811372 14:77523283-77523305 GACTTTTAGACATTGAACCACGG + Intronic
1119902912 14:78276607-78276629 GACTCTTAGAAGTTAAATGATGG + Intronic
1122261922 14:100528568-100528590 GCCTCATAGAAAGAAAGCCAAGG - Intronic
1122685367 14:103502151-103502173 GCCTCTTGGACATCAGACCAAGG + Intronic
1125630807 15:41145540-41145562 GCTTCTTTTACATTAAACCATGG + Intergenic
1127994860 15:64147479-64147501 GCCACTTGGAAATAGAACCAAGG - Intergenic
1131810184 15:96165145-96165167 GCATCTTCGAATTTAAACCCTGG - Intergenic
1133351118 16:5101137-5101159 GCCTTTTAGAAGTTAAGCTATGG + Intergenic
1136706586 16:32193954-32193976 GCCTTTTAGAAATTAAATTTTGG + Intergenic
1136761325 16:32735463-32735485 GCCTTTTAGAAATTAAATTTTGG - Intergenic
1136806778 16:33134923-33134945 GCCTTTTAGAAATTAAATTTTGG + Intergenic
1140281011 16:73555455-73555477 GCCTCTTAAAAATACAAACATGG - Intergenic
1140996922 16:80269418-80269440 GCTTTTTAAAAATTAAACTATGG - Intergenic
1203063477 16_KI270728v1_random:995780-995802 GCCTTTTAGAAATTAAATTTTGG - Intergenic
1144825288 17:18102307-18102329 GCCTCTTAGCCATTCAACCTTGG - Intronic
1149007156 17:51817895-51817917 GCCACTTACTAATTACACCACGG - Intronic
1154324123 18:13377560-13377582 TCCTCTTAGAACTTAAACTTCGG - Intronic
1155504576 18:26520859-26520881 GCCTTTAGGAAATTAAAACAGGG - Intronic
1157421375 18:47550351-47550373 TCCTCTTAGAAATTATCCAAAGG - Intergenic
1158025814 18:52896083-52896105 GCATCATAGCAATTTAACCACGG - Intronic
1158464286 18:57676006-57676028 TGCTCTTAGAAAATAAGCCAGGG - Intronic
1158777271 18:60599268-60599290 ATTTCTTAGAAATTAAAACATGG - Intergenic
1159962152 18:74563733-74563755 GCCTCCTAGAAAATAACCCAGGG - Intronic
1161529889 19:4781998-4782020 GTTTCTTAGAAACTAAACCATGG + Intergenic
1164731532 19:30508606-30508628 GCCTCTTAGAAATTAAACCAGGG - Intronic
1164791179 19:30983204-30983226 GCCACTTTCAAATTCAACCAAGG - Intergenic
926511996 2:13792685-13792707 GCTTATTAAAAAGTAAACCAGGG - Intergenic
927402323 2:22726878-22726900 TCCTCAAAGAAATTAAAACAAGG - Intergenic
932171283 2:69558801-69558823 GCCTCTGAGAAATAAAGCCTCGG + Intronic
932696549 2:73961728-73961750 GCCTTTTAGAAAGTAAACGTTGG + Intergenic
933077735 2:77950860-77950882 GCCTCTTCTACTTTAAACCATGG + Intergenic
934181806 2:89629870-89629892 GCATTTTAGAAATTAAAACTAGG - Intergenic
934292110 2:91704089-91704111 GCATTTTAGAAATTAAAACTAGG - Intergenic
935736362 2:106109583-106109605 GCCTCTTCGAAAATAAACTTAGG + Intronic
936516688 2:113185589-113185611 GCCTCTTTAAAATTAAATGAAGG + Intronic
937150844 2:119684630-119684652 GCCTCTGAGCAATTACAGCAAGG + Intronic
937195096 2:120147340-120147362 GCCCCTTAGAAAAAAAACCAGGG - Intronic
942289054 2:174451495-174451517 GCCTGAAGGAAATTAAACCATGG - Intronic
942914014 2:181280589-181280611 GACTCTTAGAAATAACACCCTGG + Intergenic
944028108 2:195196672-195196694 TACTCTTAGAAATTAAAGGATGG - Intergenic
944417507 2:199493406-199493428 CCTTCTTAAAAATTAAATCATGG - Intergenic
946380812 2:219347548-219347570 GCCTCTTAAAAATGAGACCTAGG + Intergenic
947421092 2:229942178-229942200 GCTACTTAGAAATAAAATCAAGG + Intronic
948012189 2:234657692-234657714 GCCTCTTAGAATTTGAACAGAGG + Intergenic
948068411 2:235100200-235100222 GCCTTTTAAAAAATAAACCAAGG - Intergenic
948601561 2:239110515-239110537 GCTTCTCAGAAAGAAAACCATGG - Intronic
1169450657 20:5707929-5707951 GTCTCTTAAAAAACAAACCAAGG - Intergenic
1171228096 20:23458049-23458071 GTCTCCTAGCAATTAATCCATGG - Intergenic
1172224796 20:33298219-33298241 GTATCTGAGAAATTAAAGCATGG + Intronic
1173692114 20:44968612-44968634 TCCTCTTTTCAATTAAACCAAGG - Intronic
1175203556 20:57293912-57293934 GCCACTTAAATATCAAACCATGG + Intergenic
1175283050 20:57818152-57818174 ACCTCTAAAAAATTAAACAATGG + Intergenic
1176730671 21:10493347-10493369 GCATTTTAGAAATTAAAACTAGG + Intergenic
1177545658 21:22554910-22554932 GCCTCTTAGAGTCTAAAGCAGGG + Intergenic
1180706239 22:17811719-17811741 GCCTCTAAGAAAATGAAACAAGG + Intronic
1182140916 22:27957305-27957327 GCTTTTTAAAAATTAAACCTGGG - Intergenic
1184123556 22:42470571-42470593 GCTTGTTAGGAATTAACCCAAGG + Intergenic
955302838 3:57799622-57799644 GCCTCTTATATATTAAAAAATGG - Intronic
956565263 3:70629674-70629696 GACTGTTAGAAATTAATCCCTGG - Intergenic
956627565 3:71281705-71281727 GCTTTTCAGAACTTAAACCATGG - Intronic
956924666 3:73970881-73970903 GCCACTTAGAAAACAAACCAGGG - Intergenic
957055364 3:75438475-75438497 GCCTTTTAGAAGTTAAGCTATGG + Intergenic
961299452 3:125913182-125913204 GCCTTTTAGAAATTAAGCTATGG - Intergenic
961889036 3:130114860-130114882 GCCTTTTAGAAGTTAAGCTATGG + Intergenic
962470112 3:135699308-135699330 GCCTCTTCAAATATAAACCATGG - Intergenic
964667154 3:159187363-159187385 GACTCTTTGGAATGAAACCAAGG + Intronic
965118968 3:164525234-164525256 ATCTCTTAGAAATTTCACCAAGG + Intergenic
965961426 3:174433009-174433031 CTTTCTTAGTAATTAAACCATGG - Intergenic
968998179 4:3958781-3958803 GCCTTTTAGAAGTTAAGCTATGG + Intergenic
969816150 4:9689038-9689060 GCCTTTTAGAAATTAAGCTATGG - Intergenic
971050046 4:22851300-22851322 GCCTCTTGGAACTTAAATAAAGG - Intergenic
971761180 4:30767442-30767464 GCCTCTGAGAAATTAATGAAGGG + Intronic
972259659 4:37395622-37395644 GGATCTGAGAAATTGAACCAAGG - Intronic
972553294 4:40154191-40154213 GGTTCTCTGAAATTAAACCAGGG + Exonic
973693068 4:53460070-53460092 GCCTCCTAGAAACTACACTATGG - Intronic
974360094 4:60866197-60866219 TCCTCTTAGAAAGTAAATCAAGG - Intergenic
977539102 4:98293782-98293804 GACTGTTAGAAATGAAACAATGG - Intronic
981626754 4:146765501-146765523 GCCCATTAGAAATTAAATCGTGG - Intronic
981654271 4:147094101-147094123 GTCTTTTAAAAATTAAAACAGGG + Intergenic
982411482 4:155082631-155082653 ACCTCTTTGAAATGAATCCAAGG - Intergenic
982946657 4:161632818-161632840 AACTCTTAGAAAATAAACAAGGG + Intronic
983621634 4:169767783-169767805 TCCTCTAAGAATTTAAACTAAGG - Intergenic
985161157 4:187046322-187046344 GCCTCTTAGAGATTTCCCCATGG + Intergenic
986541433 5:8848556-8848578 GCTTCTTACAAATCAACCCATGG - Intergenic
987265311 5:16247232-16247254 TGCTCTTAGAAAATAGACCAAGG - Intergenic
987346587 5:16984291-16984313 GCCTGTTAGAAATGAAATCCTGG - Intergenic
988787070 5:34574923-34574945 ACTTCTTAGATATTAAACCAAGG + Intergenic
988939110 5:36123864-36123886 TCCTATAAGAAAATAAACCAAGG - Intronic
993826873 5:92699888-92699910 CCATCTTAAAAATTAAACTATGG - Intergenic
995566780 5:113439145-113439167 ACCTTTTCCAAATTAAACCATGG - Intronic
995727192 5:115193691-115193713 ACCTCCTAGAAATTAAAAAATGG + Intergenic
996422118 5:123274217-123274239 CCATCTTACAAAGTAAACCAAGG - Intergenic
996816939 5:127584580-127584602 ACCTCTTAGCATTTAACCCAAGG - Intergenic
998135121 5:139670375-139670397 GCCTCTGAGAAACCAACCCAGGG - Intronic
998964569 5:147525223-147525245 TTCTCCTATAAATTAAACCATGG + Intergenic
999936442 5:156491699-156491721 GCCAATTAGAAATTAAAGTAGGG - Intronic
1000056184 5:157608696-157608718 CCCTATTAGAAATTTGACCACGG + Intergenic
1001404904 5:171469339-171469361 GTCTATTAGAAATGAAGCCAGGG + Intergenic
1003669826 6:8146783-8146805 CCCTCTGAGAAATTAAAGGAGGG - Intergenic
1004329883 6:14711666-14711688 GCCTGTTAGAAATTCAACTGAGG + Intergenic
1008481319 6:51988763-51988785 GGCTCTGAGAAATTAAGTCAAGG + Intronic
1009557112 6:65185606-65185628 GCTTCTTTGAAATTAAAGTAAGG - Intronic
1011752364 6:90465999-90466021 TCCTCTTGGAAAATAAATCATGG + Intergenic
1012175929 6:96084617-96084639 GTCTCATAGAAATTAGACTAAGG + Intronic
1014123911 6:117755363-117755385 GCTGCTTTGAAACTAAACCACGG - Intergenic
1017378493 6:153798815-153798837 GCTTCTTTTAATTTAAACCATGG + Intergenic
1018019845 6:159751502-159751524 TCCACTTAGAAATTAAACAATGG - Intronic
1022492138 7:30829028-30829050 GCCTCTTAGTAAGTTAACTAAGG + Intronic
1024613102 7:51083926-51083948 GCCACTTAAAATTTAAACCAGGG + Intronic
1024785450 7:52902049-52902071 GCCTATTTGAAATGAAATCATGG + Intergenic
1027997052 7:85437408-85437430 GACTCTCAGAAATAAAACCAAGG + Intergenic
1029021687 7:97371078-97371100 GCCTTGAAGAAATTAAAGCAGGG + Intergenic
1030548264 7:110926065-110926087 GCCTCTTAGAAAATATACAGAGG - Intronic
1031244916 7:119299256-119299278 GCCTCTTAAAAATAAAACAAAGG - Intergenic
1033279655 7:139996599-139996621 GCCACTTAGGAATGAAACCAGGG + Intronic
1033850002 7:145483396-145483418 GCCTCTTTTACTTTAAACCATGG + Intergenic
1034598911 7:152228179-152228201 GCATTTTAGAAATTAAAACTAGG - Intronic
1036379064 8:8225179-8225201 GCCTTTTAGAAGTTAAGCTATGG - Intergenic
1040402727 8:47068518-47068540 GCCTCTTTTACTTTAAACCATGG - Intergenic
1042169053 8:65974784-65974806 AGTTCTTAGAAATTAAAACAAGG + Intergenic
1045342875 8:101270078-101270100 GCCTTGAAGAAAATAAACCAGGG + Intergenic
1046463814 8:114576021-114576043 GACTTTTAGTAATTAAAACAAGG - Intergenic
1046906033 8:119573983-119574005 GCCTCCTAAAAATCCAACCAAGG + Intronic
1048130958 8:131696725-131696747 TACTGTTACAAATTAAACCATGG - Intergenic
1051881864 9:21848569-21848591 CCCTCCTCTAAATTAAACCAAGG - Intronic
1056994106 9:91439228-91439250 AGCACTTAGAAATTTAACCAAGG - Intergenic
1187660723 X:21544490-21544512 GCCTTAAAGAAATTAAACCTAGG + Intronic
1188034061 X:25296961-25296983 GCTTCTTAGTAACTAAACCAGGG - Intergenic
1188503573 X:30855997-30856019 GCCTTTTAAAAACTAAAGCATGG - Intronic
1193184352 X:78494832-78494854 GCCTCATAGAAATTTGACCAAGG + Intergenic
1195649724 X:107272446-107272468 GCCTCTTAGAAATAAACAGAGGG + Intergenic
1197258637 X:124291985-124292007 GGCTCTTAGAAATTAAAAACTGG - Intronic
1198321571 X:135522271-135522293 GCCACGTAGGAATTAATCCAGGG + Intronic
1198425637 X:136517115-136517137 TCATTTTAGAAATCAAACCAAGG - Intergenic
1199509802 X:148609331-148609353 GCTTGTTATAAATTACACCAAGG - Intronic
1201220110 Y:11760579-11760601 GTCTCTTAGAAGAGAAACCAAGG + Intergenic