ID: 1164731643

View in Genome Browser
Species Human (GRCh38)
Location 19:30509905-30509927
Sequence CACTACCCACCACAGGAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 156}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164731643_1164731649 18 Left 1164731643 19:30509905-30509927 CCATGTTCCTGTGGTGGGTAGTG 0: 1
1: 0
2: 1
3: 13
4: 156
Right 1164731649 19:30509946-30509968 CTTGTTTTATCAAGATGAGTGGG 0: 1
1: 0
2: 1
3: 14
4: 152
1164731643_1164731648 17 Left 1164731643 19:30509905-30509927 CCATGTTCCTGTGGTGGGTAGTG 0: 1
1: 0
2: 1
3: 13
4: 156
Right 1164731648 19:30509945-30509967 TCTTGTTTTATCAAGATGAGTGG 0: 1
1: 0
2: 0
3: 19
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164731643 Original CRISPR CACTACCCACCACAGGAACA TGG (reversed) Intronic
904327659 1:29738021-29738043 AACCACCCACCCCAGGAACATGG - Intergenic
904622851 1:31785637-31785659 CACTGCCCACCACCGGAATGGGG - Intergenic
912989217 1:114467296-114467318 CATTACCCACACCAGGAACTTGG - Intronic
914396567 1:147275178-147275200 CACTTCTCACCGCTGGAACAAGG + Intronic
917625793 1:176844794-176844816 CATTACTCAGCTCAGGAACATGG + Exonic
920377590 1:205517453-205517475 CACAACACACCACTGGCACAGGG - Intronic
920676568 1:208042359-208042381 CACACCCCACCCCAGGTACAAGG - Exonic
921196511 1:212762535-212762557 CAAGAACCACCACAGGAAGATGG + Intronic
922789526 1:228303569-228303591 CACAAACCACCACAGGACCATGG - Intronic
922789625 1:228304197-228304219 CACAAACCACCAAAGGACCATGG - Intronic
1067020473 10:42792327-42792349 CACCATCCACCAGAGGAAAAGGG - Intronic
1071565577 10:86669840-86669862 TACTGCCCACCAGGGGAACAAGG + Intronic
1071606886 10:87000152-87000174 CACCACCCACCAGAGGAAAAGGG - Intergenic
1073204876 10:101763494-101763516 CACAACCCTCCACGGCAACATGG + Intergenic
1074413991 10:113251173-113251195 GTCTCCGCACCACAGGAACAAGG + Intergenic
1074930950 10:118125418-118125440 CACTATTCACAATAGGAACATGG - Intergenic
1074965203 10:118484916-118484938 CACTGCTCACAACAGGAAAATGG + Intergenic
1075095737 10:119469405-119469427 CACTCGAGACCACAGGAACATGG - Intergenic
1076195264 10:128513171-128513193 CCCTAACCAGCACAGGACCAGGG - Intergenic
1076266993 10:129116510-129116532 CAGAGCCCAGCACAGGAACATGG + Intergenic
1078412522 11:11138123-11138145 CACAACACACCTCAGCAACATGG - Intergenic
1080854056 11:36096429-36096451 CTGTACCCACCACATGAATATGG + Intronic
1083264000 11:61537769-61537791 CACCAACCACCAGAGAAACAGGG + Intronic
1083900890 11:65642726-65642748 CACCACCCAGCCCAGGATCAGGG - Intronic
1084851464 11:71944626-71944648 CAATGCCCTCCACAGGAGCACGG - Intronic
1090269059 11:125373103-125373125 CACTGCCCAACACAGGGCCATGG - Intronic
1090707662 11:129354003-129354025 CACTACTCACCACAAGAAAAAGG + Intergenic
1092045986 12:5432210-5432232 CACTACCCAGCAGGGGAAAAAGG - Exonic
1093674263 12:21917081-21917103 CATTACCCAATACAGGAACAGGG + Exonic
1093773814 12:23049047-23049069 CAATGCCCACTACAGGAAGATGG - Intergenic
1098302793 12:69070998-69071020 CACTTCCTCCCACAGGAACTAGG + Intergenic
1101078902 12:101161319-101161341 GAAAACCCAACACAGGAACAGGG + Intronic
1104067960 12:125320725-125320747 CACCACGCACCATAGGGACAAGG + Intronic
1112115186 13:96344621-96344643 CACTAACCACCACAGGAGAGAGG - Intronic
1112340888 13:98552268-98552290 AACGACCACCCACAGGAACAAGG + Intronic
1113579417 13:111418564-111418586 CAGTACCCAAGACAAGAACATGG + Intergenic
1120672961 14:87385849-87385871 CAGTAACATCCACAGGAACAAGG - Intergenic
1122460907 14:101893947-101893969 CACGCCCCAGCACAGGCACAGGG + Intronic
1122837295 14:104436512-104436534 CCATTCCCACCACAGGACCAAGG + Intergenic
1124397852 15:29320211-29320233 ACCTTCCCACCACAGCAACAGGG + Intronic
1124844713 15:33279192-33279214 CACTTCCCATCACTTGAACAGGG - Intergenic
1124857789 15:33407453-33407475 CATGACCCACCACAGGAACATGG - Intronic
1130760958 15:86819190-86819212 CACTACCGACCTCAGCATCATGG - Intronic
1131018439 15:89077094-89077116 CACCACCCAGCTCAGGAACAGGG + Intergenic
1131176421 15:90212163-90212185 CACTCCCCACCCCAGGAAGTGGG - Intronic
1132072190 15:98788011-98788033 CCCTACCCACCATAGGAACGTGG - Intronic
1133781354 16:8941674-8941696 CACTCCTCACCACACCAACACGG - Intronic
1138659320 16:58508284-58508306 CCCTACCCACCTCAGGCCCAGGG + Intronic
1141048628 16:80740000-80740022 CACCACCCTCCACAGCCACATGG - Intronic
1142630697 17:1224208-1224230 CACTCCTCACCACACCAACACGG + Intronic
1143319304 17:6057745-6057767 TGCTGCCCACCAGAGGAACAGGG + Intronic
1143568373 17:7739068-7739090 CACCTCCCACCCCAGGAACCAGG + Intronic
1145758614 17:27411070-27411092 CATTACTCACCACAAGAAAAAGG + Intergenic
1146689973 17:34866608-34866630 GACTGCCCCCCTCAGGAACAGGG + Intergenic
1147689056 17:42304408-42304430 CAGTGCCCACTTCAGGAACATGG + Exonic
1150315722 17:64167084-64167106 CACTTCCCACCAAAGGCAGATGG - Intronic
1150672719 17:67215775-67215797 CACTAGCCACCACAGTAAGGTGG + Intronic
1151977970 17:77492988-77493010 CACTGCCCACCACAGCAAATGGG - Exonic
1152378822 17:79931716-79931738 CACCACCCACCCCAAGAGCAGGG - Intergenic
1153974818 18:10259610-10259632 CACTCCCCACCACACACACACGG - Intergenic
1157247688 18:46068995-46069017 CCCTGCCCACTACAGGAACAGGG + Intronic
1158430889 18:57386269-57386291 CACTCCTCCCCACAGGGACAGGG - Intergenic
1158632421 18:59127200-59127222 ATCTACATACCACAGGAACAGGG + Intergenic
1160306638 18:77745975-77745997 CACTGCTCACAACAGTAACATGG - Intergenic
1162274122 19:9639633-9639655 CAATACCCACAACAGTTACAGGG + Intronic
1163382962 19:16980732-16980754 TGCAACCCACCACAGGAAGACGG + Intronic
1163383195 19:16982191-16982213 CAAGACCCGCCACAGCAACATGG + Intronic
1164731643 19:30509905-30509927 CACTACCCACCACAGGAACATGG - Intronic
926225776 2:10965986-10966008 CATCACCCATCACAGGGACAAGG + Intergenic
927990742 2:27445254-27445276 TTCTACCCACCACAGGATCTGGG + Intronic
928255071 2:29715085-29715107 CACTTCCCACATCAGGCACAGGG + Intronic
931054410 2:58452885-58452907 CAGAACCCAGCACAGGAAGAAGG - Intergenic
933311151 2:80662832-80662854 CTCTACTCAACACAGAAACATGG - Intergenic
935694899 2:105762525-105762547 CACTCACCACCACAGGCCCATGG - Intronic
936228848 2:110681888-110681910 CGCTAACCATCACAGGAACTAGG + Intergenic
943153278 2:184141016-184141038 CACTTCCCAGCCCAGGACCACGG - Intergenic
945444302 2:209917780-209917802 CACTGCACACAGCAGGAACATGG - Exonic
948490549 2:238309925-238309947 CAGCACCCACCACAGGGCCAAGG + Intergenic
948966302 2:241383366-241383388 CCCCTCCCACCACAGGAACAGGG - Intronic
948969274 2:241412094-241412116 AACTACCCAGATCAGGAACAGGG - Intronic
1168967586 20:1908218-1908240 CACTCCCGAACACAGGCACACGG + Intronic
1170481019 20:16764882-16764904 CACTACCCACTAGTGGAACTTGG + Intronic
1172885769 20:38229856-38229878 CACTTTCCACCACAGAAAAAGGG + Intronic
1174195412 20:48769363-48769385 CCCCGCCCACCACAGGCACAGGG + Intronic
1179591876 21:42414470-42414492 CTCTACACACCACAGGACCTTGG - Intronic
1179942376 21:44648586-44648608 CACCACTAACCAAAGGAACAGGG + Intronic
1182418013 22:30233584-30233606 CAGTACCCAGCACAGGGCCAGGG - Intergenic
1182666780 22:31965861-31965883 CACTACTCACAACAGAAACCTGG - Intergenic
1182685972 22:32122066-32122088 CACCACCAACCACAGCAGCAAGG - Intergenic
1182961143 22:34476389-34476411 CACTTCCAGCCACAGGGACATGG - Intergenic
1184317799 22:43710788-43710810 CACTCCCCACAAAATGAACATGG + Intronic
1184502759 22:44883711-44883733 CTCTACGCACCACCGCAACAAGG + Intronic
1184512501 22:44941845-44941867 CAGCACCCACCCCAGGTACAGGG + Intronic
1184771608 22:46600218-46600240 CACATCCCACCACTGGAACAGGG - Intronic
950620870 3:14204252-14204274 CAGTGCCCACCTCAGGAAGAAGG + Intergenic
951561666 3:23973381-23973403 CAGTACTCAGCACAGTAACATGG - Intronic
951630705 3:24716812-24716834 CACTTCCCTCCACCTGAACATGG + Intergenic
955950706 3:64239581-64239603 CACTCCCAGCCACAGGGACAGGG + Intronic
957643085 3:82884492-82884514 CATGACCCATCACAGAAACAAGG - Intergenic
960083845 3:113569712-113569734 CTCTATCCTCCACAAGAACAAGG + Intronic
965116384 3:164495147-164495169 TACTTCCCATCATAGGAACAAGG + Intergenic
968957060 4:3724940-3724962 TACCACCCTCCACAGGAAGAGGG - Intergenic
969191981 4:5529243-5529265 GGCTACCCACCTCAGGTACATGG + Intergenic
970591451 4:17563753-17563775 CCCTATCATCCACAGGAACATGG + Intergenic
971072361 4:23109307-23109329 CACTTCTCACCAAAAGAACATGG - Intergenic
972162772 4:36245534-36245556 CACTTCCATCAACAGGAACAGGG - Intergenic
974297318 4:60018305-60018327 CATTAGCAACCACAGGAAGATGG + Intergenic
974819619 4:67049729-67049751 CACAACCTACCTCAGGAACCAGG - Intergenic
975465577 4:74705405-74705427 CACTACTTACCAGAGGAACCAGG - Intergenic
977804679 4:101282761-101282783 CACCTCGCACCACAGAAACATGG + Intronic
978874306 4:113620204-113620226 CTCTACACACCACAGAACCAAGG - Intronic
979047254 4:115883884-115883906 CTCTAACCAAGACAGGAACATGG + Intergenic
982285321 4:153728116-153728138 CACTCCCCAACCCAGGAAAATGG + Intronic
985066077 4:186123597-186123619 CACGACCCACTGCAGGATCAAGG + Intronic
985566436 5:620701-620723 CACACCCCACCACTGGGACAGGG + Intronic
985645019 5:1080710-1080732 CCCCACCCACCGCCGGAACAAGG + Intronic
986293741 5:6420608-6420630 CACAACCCACCACAAGCCCAAGG + Intergenic
986332359 5:6726925-6726947 CACTCCCACCCACAGGAAGATGG - Intronic
986909488 5:12536306-12536328 CACTGCACACAACAGCAACAGGG + Intergenic
993571281 5:89542206-89542228 CACTACCCACTTCAGGAAAGGGG + Intergenic
994224033 5:97231219-97231241 CACTGCCCCCTAGAGGAACAAGG - Intergenic
994913077 5:105938317-105938339 ACCTTCCCACCTCAGGAACAGGG + Intergenic
998440056 5:142152035-142152057 CCCTACCGACTACAGGGACATGG - Exonic
1005158427 6:22834682-22834704 CAATACCCACCACACTATCATGG + Intergenic
1006192318 6:32217194-32217216 CACTGCCCACCATTGGCACAGGG + Exonic
1006253927 6:32814317-32814339 CACTCCACTCCACAGAAACAGGG + Exonic
1006326740 6:33360045-33360067 CAATACCCATCACTGGAAAAGGG - Intergenic
1007097878 6:39225468-39225490 CACTGCCCACCAGAGGCAGAAGG + Intronic
1007415447 6:41688834-41688856 GACTCCCCACCACAGGAACTGGG + Intronic
1008172188 6:48221787-48221809 TACTAATCAGCACAGGAACACGG - Intergenic
1008628087 6:53337139-53337161 CACTACCCTTCACACGAACATGG + Intronic
1010096585 6:72053434-72053456 AACAAACCACTACAGGAACAGGG - Intronic
1012203658 6:96436024-96436046 CAAAAACTACCACAGGAACATGG + Intergenic
1012205044 6:96450859-96450881 CACTGCCCTCCACAGTATCAGGG + Intergenic
1017115510 6:150972646-150972668 CAGTACGCTCCACAGGAGCAGGG - Intronic
1017129888 6:151099269-151099291 CACCACCCACCTCTGGAGCATGG + Intronic
1017546716 6:155459740-155459762 CAGTAGCCACCTCAGAAACAAGG - Intergenic
1018526282 6:164713438-164713460 CACTCACTATCACAGGAACAAGG - Intergenic
1019145571 6:169973421-169973443 CACCACCCTCCACAGTGACATGG - Intergenic
1019145611 6:169973608-169973630 CACCACCCTCCACAGTGACATGG - Intergenic
1019145617 6:169973634-169973656 CACCACCCTCCACAGTGACATGG - Intergenic
1019145630 6:169973687-169973709 CACCACCCTCCACAGTGACATGG - Intergenic
1019145684 6:169973928-169973950 CACCACCCTCCACAGTGACATGG - Intergenic
1019646135 7:2129985-2130007 CACTACCCAACAGAGGGGCAGGG + Intronic
1022610542 7:31867332-31867354 CAATACCCTCCACAGTAGCAGGG + Intronic
1027150638 7:75731135-75731157 CAATACCCACTAAAGGAGCAAGG + Intronic
1030561375 7:111091161-111091183 CACTAACCACCATGGAAACAAGG + Exonic
1033472564 7:141663103-141663125 CACTTCCCTCAACAGGAAAATGG - Intronic
1034206334 7:149319016-149319038 CACTACCCAGCTGAGGGACAAGG - Intergenic
1034866103 7:154643767-154643789 CACTACCCACCAAAGAAGGAGGG + Intronic
1037201400 8:16257480-16257502 CAATATCAGCCACAGGAACATGG + Intronic
1038128206 8:24697828-24697850 TACTCTCCACAACAGGAACAGGG + Intergenic
1041793592 8:61722929-61722951 CATTACCCACCACTGGCCCAAGG - Intergenic
1042936977 8:74069434-74069456 CACTGCCCATCACAGGAACGAGG - Intergenic
1043417147 8:80063112-80063134 CACTACCCACCATAGTCAAAAGG + Intronic
1043661063 8:82741979-82742001 AATTACCCACCTGAGGAACAAGG + Intergenic
1051666553 9:19471897-19471919 CACTGCCCGCCCCAGGACCAAGG - Intergenic
1055360743 9:75488072-75488094 CACCATGCACCACAGGACCAGGG + Intergenic
1056650996 9:88462306-88462328 CACTCACCACCACTGGTACAGGG + Intronic
1057957396 9:99422150-99422172 AACTACCGAGAACAGGAACAAGG + Intergenic
1058937804 9:109785331-109785353 CTCTACACACCTCAGGAAGAAGG - Intronic
1061439197 9:130588357-130588379 CACTACCCACCCCACCAACCAGG - Intronic
1061805344 9:133134654-133134676 GACCACCCACCCCAGGGACAGGG - Intronic
1186703861 X:12121598-12121620 CACCACCCACCATAAGACCATGG - Intergenic
1188072794 X:25737527-25737549 TACTAATCACCACGGGAACACGG - Intergenic
1191991181 X:67038732-67038754 CAGTATTCACCACAGGCACAGGG - Intergenic
1196009221 X:110869139-110869161 CACTATTCACCATAGCAACAAGG + Intergenic
1196867811 X:120085521-120085543 CACTGCCCACCCCAGTTACAAGG - Intergenic
1196875291 X:120150760-120150782 CACTGCCCACCCCAGTTACAAGG + Intergenic
1197131577 X:123011474-123011496 CACTACCCACTGCAGGATTAAGG - Intergenic
1199490011 X:148387624-148387646 CACTGCCCTCCCCAGTAACAGGG + Intergenic