ID: 1164734506

View in Genome Browser
Species Human (GRCh38)
Location 19:30530959-30530981
Sequence GTGCTGGCAGGACACCCGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164734506_1164734511 5 Left 1164734506 19:30530959-30530981 CCCTGCGGGTGTCCTGCCAGCAC 0: 1
1: 0
2: 1
3: 19
4: 182
Right 1164734511 19:30530987-30531009 CCCCCAGCCTTCACTGTGCTTGG 0: 1
1: 1
2: 1
3: 34
4: 323
1164734506_1164734516 21 Left 1164734506 19:30530959-30530981 CCCTGCGGGTGTCCTGCCAGCAC 0: 1
1: 0
2: 1
3: 19
4: 182
Right 1164734516 19:30531003-30531025 TGCTTGGCTTTCAGCCTCTCTGG 0: 1
1: 0
2: 0
3: 30
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164734506 Original CRISPR GTGCTGGCAGGACACCCGCA GGG (reversed) Intronic
900013247 1:133346-133368 GTGCGGTCAGGACCCCCACAGGG - Intergenic
900043312 1:489333-489355 GTGCGGTCAGGACCCCCACAGGG - Intergenic
900064749 1:724330-724352 GTGCGGTCAGGACCCCCACAGGG - Intergenic
900616140 1:3566525-3566547 TTGCTGGAAGGAACCCCGCAGGG + Intronic
901630599 1:10646374-10646396 GTGAAGTCAGGACACCAGCAGGG - Intronic
903497410 1:23778828-23778850 GAGCTGGCAGGAGACAGGCACGG - Intronic
903597021 1:24502818-24502840 GTTCTGGCAGGGCGCGCGCACGG - Intronic
903943973 1:26950394-26950416 GTGCTGGAAAGACACCCGTGTGG - Intronic
905869464 1:41394827-41394849 CTGCTGGCAGGACCCTGGCAGGG + Intergenic
906082353 1:43101704-43101726 GAGCTCACAGGACACCTGCAGGG + Intergenic
906215573 1:44036248-44036270 GTCCTGGCAGAACCCCAGCAAGG + Intergenic
906656842 1:47554383-47554405 GAACTCGCAGGACACCAGCAGGG - Intergenic
907472190 1:54681056-54681078 CTGCTGCAAGGACCCCCGCAAGG - Intronic
912467770 1:109885908-109885930 GTGCTCCCAGGACACCCTCCTGG - Intergenic
913960854 1:143337165-143337187 GTGACGGCAGGACACATGCATGG - Intergenic
914055208 1:144162737-144162759 GTGACGGCAGGACACATGCATGG - Intergenic
914123938 1:144803624-144803646 GTGACGGCAGGACACATGCATGG + Intergenic
918516579 1:185370057-185370079 GGTCTGCCAGGACACCAGCAAGG + Intergenic
920255214 1:204650050-204650072 GTGCTGGCAGGACAGAGGGAGGG - Intronic
920637787 1:207721270-207721292 GTGGTTGCAGCACACCAGCATGG - Intronic
922261684 1:223949844-223949866 GTGCGGTCAGGACCCCCACAGGG - Intergenic
924342848 1:243052018-243052040 GTGCGGTCAGGACCCCCACAGGG - Intergenic
1063613133 10:7580061-7580083 GTGCCTGCAGGACACCAACACGG + Exonic
1064770849 10:18721284-18721306 GTGCTGATAGGGCACCCTCAAGG - Intergenic
1067433886 10:46264119-46264141 TGGCAGGCAGGACACCCACAGGG + Intergenic
1068806622 10:61201887-61201909 GTGCTGCCAGGACATAGGCATGG + Intergenic
1070333159 10:75431956-75431978 GTGCGGGAAGAACACCCGCAAGG + Intronic
1072234783 10:93444169-93444191 GAGCTGACAGGACAGCTGCAAGG + Intronic
1073054285 10:100689169-100689191 CTGCTGGGAGGAGACCCGCACGG + Intergenic
1076969584 11:125550-125572 GTGCGGTCAGGACCCCCACAGGG - Intergenic
1077237361 11:1488199-1488221 GTGCTGGCAGGTCACCCAAGTGG + Intronic
1084705277 11:70812739-70812761 GTGCAGGCAGGACAGCAGGAGGG - Intronic
1086412492 11:86556579-86556601 GTGCTGACAGGCCAGCCCCACGG + Exonic
1088532671 11:110827697-110827719 GTGATGGCATGACATCCCCAAGG + Intergenic
1089502723 11:118941724-118941746 GTGCCTGAAGGACACCCGGATGG - Intronic
1089732361 11:120527225-120527247 GGCCTGGCAGGACCCCAGCAGGG - Intronic
1091309665 11:134563352-134563374 GGGATGGCAGGCCACCCTCAAGG + Intergenic
1091737455 12:2934593-2934615 GTGCCAGCAGGACACCAGGAGGG - Intronic
1093041096 12:14380465-14380487 GTGCTGGTCAGACACCCTCAGGG + Intronic
1094864134 12:34508791-34508813 GTGGGGGCAGCACACCAGCATGG + Intergenic
1095484531 12:42671554-42671576 ATGCTGGCAGGTCACCCTAAGGG - Intergenic
1096469314 12:51866118-51866140 GTGCTGGCAGGCCACCCCATGGG - Intergenic
1096671371 12:53200303-53200325 TGGCTGGCAGGACCCCAGCATGG + Exonic
1096847012 12:54412856-54412878 GTCCTGGCAGGAGACCCTTAGGG - Intronic
1103925618 12:124422182-124422204 GAGCTGGCAGGAGACCCGTCGGG + Intronic
1103979549 12:124727564-124727586 CTGCTGGGAGGACACAGGCAGGG - Intergenic
1106910630 13:34459761-34459783 ATGCTGTCAGGACACCCACTTGG + Intergenic
1106956488 13:34943253-34943275 GCGCAGGCAGGTCACCCGCTGGG - Intronic
1111298591 13:86316836-86316858 GTGCTGGCAGGCCACCTGCATGG + Intergenic
1111471208 13:88684478-88684500 GTGGGGGCAGCACACCAGCATGG + Intergenic
1113028771 13:105971008-105971030 GTGGGTGCAGCACACCCGCATGG - Intergenic
1113315850 13:109178185-109178207 GTGGTGGCAGGACACAGGAAAGG - Intronic
1113917523 13:113883442-113883464 GTGCTGAGGGGACGCCCGCAGGG - Intergenic
1114426669 14:22629539-22629561 GTGCAGGCAGCACACCCTAAGGG + Intergenic
1114740338 14:25090431-25090453 GTCCTGGCAGCACAACCACAGGG + Intergenic
1115117242 14:29895677-29895699 GTGCTTGCAGGACAGCAGCGAGG - Intronic
1119731732 14:76955570-76955592 GTCCTGGGAGGACAGCCTCAGGG - Intergenic
1122168917 14:99854505-99854527 GTGCAAGCAGGCCAACCGCAGGG - Intronic
1122830204 14:104392283-104392305 GCCCTGGCAGGACCCCCTCATGG + Intergenic
1123480122 15:20623275-20623297 GTGCAGGCAGGGCACAGGCAGGG + Intergenic
1123637885 15:22377089-22377111 GTGCAGGCAGGGCACAGGCAGGG - Intergenic
1124221231 15:27851424-27851446 GTGCGGGCAGGCCAACCTCAGGG + Exonic
1128331395 15:66757802-66757824 GTGCTGGCAGGACAACAGAGTGG + Intronic
1131861598 15:96659540-96659562 GTGCGTGCAGCACACCAGCATGG + Intergenic
1131995068 15:98125495-98125517 GTGCTGGCAGTCCACCCATAAGG + Intergenic
1135833368 16:25798885-25798907 GTGCTGGAAGGACAAACTCATGG - Intronic
1137803899 16:51285950-51285972 GTTCTGGCAGGACACAAGAATGG + Intergenic
1138961893 16:62037220-62037242 GTGGAGGCAGGAGAACCGCAAGG - Intergenic
1140457829 16:75115037-75115059 CTGCTGGGGGGACACCCGCGGGG - Intronic
1141747119 16:85933287-85933309 GTGATGGCCGGACTCCCTCATGG - Intergenic
1141791883 16:86242679-86242701 GTGCTGGCAGGAGACCAGTAGGG + Intergenic
1142456467 17:60123-60145 GTGCGGTCAGGACCCCCACAGGG - Intergenic
1143981271 17:10872130-10872152 CTGCTGGCAGGAAGCCCACATGG + Intergenic
1145251231 17:21298035-21298057 GTGCTGGCTGGACCCCCGCTGGG + Intronic
1147455640 17:40536540-40536562 GTGCTGGCAGCCCACCCGGAAGG + Intergenic
1147456546 17:40541750-40541772 GTGCGGGCAGGGCCCCCCCATGG + Intergenic
1150566083 17:66341689-66341711 GTGCTGGGAGCATACCTGCATGG - Intronic
1151466740 17:74290478-74290500 GGGCTGGCAAGACACAGGCAGGG + Intronic
1151756801 17:76079887-76079909 GTCCTGGCTGGACACTCGCCTGG + Exonic
1152504417 17:80738147-80738169 GTGCTGGGAGGGCAGCCCCAGGG + Intronic
1152536068 17:80951012-80951034 GTGCTGGAAGGACACACCCGTGG + Intronic
1152579063 17:81158004-81158026 GTGCTGGCTGGGCAGCAGCAGGG + Intronic
1152652305 17:81500315-81500337 GGGCTTGCAGCACACCCGCCAGG + Intergenic
1153696282 18:7646187-7646209 GTACAGGCAGGACACAGGCAAGG - Intronic
1159479484 18:68969278-68969300 GTGCTGCCAGGGCTCCCGCTAGG + Intronic
1159894197 18:73980917-73980939 GTGGGGGCAGGGCACCTGCAGGG + Intergenic
1160038407 18:75321915-75321937 GTGCTGGAAGGTCACCTGCAAGG + Intergenic
1160511573 18:79456140-79456162 CAGCTGGCAGGACACTTGCAAGG + Intronic
1160594363 18:79964004-79964026 GTCCTGGGAGGTCACCCACAAGG + Intergenic
1160646388 19:195476-195498 GTGCGGTCAGGACCCCCACAGGG - Intergenic
1160810944 19:1012696-1012718 GTGCTGGGAGGACCCCTACATGG + Intronic
1161272456 19:3397621-3397643 GGGCTGGGAGGAGACTCGCAAGG - Intronic
1162414163 19:10524408-10524430 GTGCTGGGAGGACTCTGGCAGGG - Intergenic
1162696772 19:12482784-12482806 GAGCAGGTAGGACACCTGCAGGG + Intronic
1163179876 19:15591886-15591908 GTCCTGGCAGGGAACCCACAGGG + Intergenic
1163186659 19:15643897-15643919 TTGCTTGCAGGTCACCCCCACGG + Intronic
1163718387 19:18885844-18885866 GTGGGCCCAGGACACCCGCAAGG - Intronic
1163969555 19:20779005-20779027 GAGCAGGCTGGACACCTGCACGG - Intronic
1164734506 19:30530959-30530981 GTGCTGGCAGGACACCCGCAGGG - Intronic
1165158760 19:33803683-33803705 AAGCAGGCAGGACACCAGCAAGG - Intronic
1165728671 19:38130349-38130371 GTGATGGCAGGGGACCCGCAGGG - Intronic
1202694690 1_KI270712v1_random:115414-115436 GTGACGGCAGGACACATGCATGG - Intergenic
925294569 2:2768666-2768688 GTGCTGCCACGACGCCCCCAAGG + Intergenic
925826926 2:7858529-7858551 GTGCTCACAGGATACCCCCATGG + Intergenic
928706495 2:33955242-33955264 GTCCTGGCACCACAACCGCAGGG - Intergenic
929095593 2:38260656-38260678 GTGTGGGAAGGACACCCACAGGG - Intergenic
931795257 2:65702214-65702236 ATGCTTGCAGGACACAGGCAGGG + Intergenic
932830603 2:74986134-74986156 GGGCTTGCAGGACAGCTGCAGGG - Intergenic
932939321 2:76143820-76143842 GTTCTGGCAGGACAACCCTAAGG + Intergenic
934097915 2:88624689-88624711 GTGCAGGCAGGACATCCAGAGGG - Intronic
934275862 2:91572460-91572482 GTGACGGCAGGACACATGCATGG - Intergenic
937150287 2:119681537-119681559 GTCCTGGCTGGACCGCCGCACGG + Exonic
938842384 2:135175420-135175442 CTGCTGGCAGGAACCCAGCAAGG + Intronic
943755329 2:191551086-191551108 GTGCTGGGAGTACAGGCGCAAGG + Intergenic
944861184 2:203817317-203817339 GTGCTGACAAGACACTCACATGG - Intergenic
945061158 2:205910120-205910142 CTGCTGGCAGGACTCCTGCAGGG + Intergenic
1170274310 20:14566700-14566722 TTGCTGGCAGGCCATCCTCAGGG - Intronic
1172447222 20:34999534-34999556 GTGCTGAGAGGCCACCCCCATGG - Intronic
1172942517 20:38664149-38664171 GTGCAGGCAGGAACCCCCCAGGG + Intergenic
1175955460 20:62606820-62606842 CTGCTGGCAGGGCCCCAGCACGG + Intergenic
1176279124 20:64290740-64290762 GTGCGGTCAGGACCCCCACAGGG + Intergenic
1178037781 21:28603927-28603949 GTTCAGGCAGGCCACCTGCATGG - Intergenic
1178887284 21:36494098-36494120 GTGCTGGGTGGACACCTGCTGGG + Intronic
1179491000 21:41741552-41741574 GTGCTGGCAGGCCACGTGCATGG + Exonic
1180050213 21:45327657-45327679 GTGTTGGCAGGAGCCCCGCCTGG - Intergenic
1180062664 21:45393702-45393724 GGGCTGGCATGGCAGCCGCAGGG + Intergenic
1180125651 21:45788392-45788414 GGGCAGGCAGGTCACCAGCAGGG - Intronic
1180178867 21:46108953-46108975 GAGCTCACAGGAGACCCGCAGGG + Intronic
1180786484 22:18550582-18550604 GTGCAAGCAGGACCCCAGCATGG + Intergenic
1181073981 22:20362443-20362465 GTGCGTGCAGCACACCAGCATGG + Intronic
1181131765 22:20736305-20736327 GTGCAAGCAGGACCCCAGCATGG + Intronic
1181243404 22:21490135-21490157 GTGCAAGCAGGACCCCAGCATGG + Intergenic
1184042327 22:41951525-41951547 GTGCTGGCTGTACACCAGCCAGG + Intergenic
1184357777 22:43994151-43994173 GTGCTTGCAGAAGACACGCAGGG + Intronic
951853041 3:27164253-27164275 GTGTAGGCAGGACAGCCCCAGGG + Intronic
953362367 3:42309287-42309309 GGCCTGGCAGAACACCCCCATGG - Intergenic
953578611 3:44133514-44133536 CTGATGGCAGGAAACCCCCAAGG - Intergenic
954426814 3:50447713-50447735 GTGCAGGCAGGAAACCTGGAGGG - Intronic
954637449 3:52078943-52078965 GGGCTGGCAGGCCACCTGCAGGG + Intronic
956075256 3:65498106-65498128 CTGCTGGCTGGACACACGCCTGG + Intronic
960086942 3:113601618-113601640 TTGCTGCCAGCACACCCGAAGGG + Exonic
961389748 3:126545302-126545324 GTGCTGGCAGGACACCTCCCAGG + Intronic
962255743 3:133869048-133869070 GGGCAGTCAGGACACCTGCAAGG + Intronic
963054966 3:141178929-141178951 ATGCTGCCAGCACACCCACAGGG - Intergenic
967994225 3:195154607-195154629 GGGCTTGCAGGCCACCCTCAGGG + Intronic
968371293 3:198224050-198224072 GTGCGGTCAGGACCCCCACAGGG + Intergenic
968869474 4:3234359-3234381 GTGCTAGCAGGACAGGCGGACGG + Intronic
973930524 4:55789235-55789257 GTGCTGGCAGCCCACCCTAAGGG - Intergenic
976218780 4:82739474-82739496 GTGCGGGGAGGCCACCGGCAGGG - Intronic
977157172 4:93589129-93589151 GTGCGTGCAGCACACCAGCATGG - Intronic
979328398 4:119404104-119404126 GTGGGGTCAGGACCCCCGCAGGG - Intergenic
982134020 4:152256814-152256836 GTGGAAGCAGGAGACCCGCAGGG - Intergenic
983887745 4:172999384-172999406 GTGCTGGAAGGACACTGGAAGGG - Intronic
986026088 5:3852766-3852788 GTGAAAGCAGGACACCCGCACGG - Intergenic
986272917 5:6249761-6249783 GTGTTGGCAGAGCACCCACAGGG - Intergenic
992190628 5:74288066-74288088 GTGCTGGAGGGACAACCGAAGGG - Intergenic
996925874 5:128826046-128826068 GTGCTGGCAGTAGACCCAGAAGG + Intronic
997363677 5:133311783-133311805 GAGCTGGCAGGTCACACCCAAGG + Intronic
1001705642 5:173739397-173739419 GTGCTGGCGGCACCCCAGCAGGG - Intergenic
1002564015 5:180100017-180100039 GTGGGGGCAGGGCTCCCGCAGGG - Intergenic
1002730531 5:181329596-181329618 GTGCGGTCAGGACCCCCACAGGG + Intergenic
1002753997 6:144508-144530 GTGCGGTCAGGACCCCCACAGGG - Intergenic
1002774132 6:314381-314403 GGGCTCGCAGGACACCTGCATGG - Intronic
1006678603 6:35781033-35781055 CAGCTGGGAGGACACCCACATGG + Exonic
1008030410 6:46688172-46688194 GTCCACGAAGGACACCCGCAGGG - Exonic
1009782649 6:68289957-68289979 GTGGGGGCAGCACACCAGCATGG + Intergenic
1011640573 6:89412685-89412707 GTGTTGGGAGGCCACCCGCTTGG - Intergenic
1013888927 6:115002197-115002219 GTGGTGGAAGGAGACCCGGAAGG - Intergenic
1013889970 6:115014377-115014399 GTGGGTGCAGGACACCAGCATGG + Intergenic
1018345655 6:162896453-162896475 GTGCTGGCAGCAGACCCACGAGG + Intronic
1022305903 7:29146392-29146414 GAGCTGGCACGACCCACGCAGGG + Intronic
1023401701 7:39796137-39796159 GTGGGGTCAGGACCCCCGCAGGG + Intergenic
1023883523 7:44335015-44335037 GTGCAGGCAGGAGCCCAGCAGGG - Intergenic
1026023778 7:66729692-66729714 GTGATGGCAGGAGACCCACCTGG - Intronic
1026888408 7:73967954-73967976 GTGATGGCAGGAGACCCACCTGG - Intergenic
1029231198 7:99070261-99070283 GTGCTGGCAGGGAACCCGTGGGG - Intronic
1032052207 7:128656516-128656538 GTGCGGTCAGGACCCCCACAGGG + Intergenic
1032190516 7:129762788-129762810 GCGATGGCAGGACATCCGGAAGG + Intergenic
1035321932 7:158035541-158035563 GTGCTGGCAGCGCACCCCCAAGG + Intronic
1035763885 8:2090116-2090138 GTGCTGTCAGCAAACCGGCATGG + Exonic
1036283214 8:7418813-7418835 GTGCTGGCAGGACATGTGCATGG - Intergenic
1036338256 8:7892708-7892730 GTGGTGGCAGGACATGTGCATGG + Intergenic
1036771978 8:11585312-11585334 GTGGGTGCAGGACACCTGCATGG + Intergenic
1040634148 8:49252997-49253019 GTGCAGGAAGGAGACCCACATGG + Intergenic
1040838963 8:51763469-51763491 ATGCTGGCAGGTCACCCTAAGGG + Intronic
1041660545 8:60397327-60397349 GTGCTGCCATGCCACCAGCATGG + Intergenic
1041731239 8:61065100-61065122 TTGGTTCCAGGACACCCGCAAGG + Intronic
1044060630 8:87630741-87630763 GTGGTTGCAGCACACCAGCATGG + Intergenic
1045805589 8:106157464-106157486 GTGCGTGCAGCACACCAGCATGG - Intergenic
1048398743 8:134042511-134042533 GTGATGGCAAGACACTCACAGGG - Intergenic
1050994359 9:12194978-12195000 CTGTTGGCAGGACACCAGGAAGG - Intergenic
1051365476 9:16318709-16318731 GTGCTGGCAGCCAACACGCAGGG - Intergenic
1061309816 9:129754843-129754865 GTTCTGGCAGGACCTCCACAAGG + Intergenic
1061757403 9:132824586-132824608 GTGCCTGCAGCACAACCGCAAGG + Intronic
1062754942 9:138282106-138282128 GTGCGGTCAGGACCCCCACAGGG + Intergenic
1203718294 Un_KI270742v1:177046-177068 GTGGTGGCTGGAGACCCGTATGG - Intergenic
1192946901 X:75973396-75973418 GTGCGTGCAGCACACCAGCATGG + Intergenic
1200900408 Y:8425718-8425740 GTGGTTGCAGCACACCAGCATGG + Intergenic
1201596209 Y:15672470-15672492 GTGGTTGCAGAACACCAGCATGG - Intergenic
1202274194 Y:23098697-23098719 GTGCTGGCAGGCCACCCCAAGGG + Intergenic
1202291832 Y:23321980-23322002 GTGCTGGCAGGCCACCCCAAGGG - Intergenic
1202427190 Y:24732442-24732464 GTGCTGGCAGGCCACCCCAAGGG + Intergenic
1202443601 Y:24937652-24937674 GTGCTGGCAGGCCACCCCAAGGG - Intergenic