ID: 1164736997

View in Genome Browser
Species Human (GRCh38)
Location 19:30548941-30548963
Sequence AACTGCTTGTAGAAGTCTGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 128}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1164736997_1164737005 9 Left 1164736997 19:30548941-30548963 CCATCAGACTTCTACAAGCAGTT 0: 1
1: 0
2: 0
3: 6
4: 128
Right 1164737005 19:30548973-30548995 CCCAGGCATGGTTGGCTCAGGGG 0: 1
1: 0
2: 1
3: 21
4: 221
1164736997_1164736999 -8 Left 1164736997 19:30548941-30548963 CCATCAGACTTCTACAAGCAGTT 0: 1
1: 0
2: 0
3: 6
4: 128
Right 1164736999 19:30548956-30548978 AAGCAGTTTGGTGTTTACCCAGG 0: 1
1: 0
2: 2
3: 33
4: 332
1164736997_1164737003 8 Left 1164736997 19:30548941-30548963 CCATCAGACTTCTACAAGCAGTT 0: 1
1: 0
2: 0
3: 6
4: 128
Right 1164737003 19:30548972-30548994 ACCCAGGCATGGTTGGCTCAGGG 0: 1
1: 0
2: 2
3: 16
4: 184
1164736997_1164737001 1 Left 1164736997 19:30548941-30548963 CCATCAGACTTCTACAAGCAGTT 0: 1
1: 0
2: 0
3: 6
4: 128
Right 1164737001 19:30548965-30548987 GGTGTTTACCCAGGCATGGTTGG 0: 1
1: 0
2: 1
3: 10
4: 123
1164736997_1164737002 7 Left 1164736997 19:30548941-30548963 CCATCAGACTTCTACAAGCAGTT 0: 1
1: 0
2: 0
3: 6
4: 128
Right 1164737002 19:30548971-30548993 TACCCAGGCATGGTTGGCTCAGG 0: 1
1: 0
2: 1
3: 13
4: 164
1164736997_1164737000 -3 Left 1164736997 19:30548941-30548963 CCATCAGACTTCTACAAGCAGTT 0: 1
1: 0
2: 0
3: 6
4: 128
Right 1164737000 19:30548961-30548983 GTTTGGTGTTTACCCAGGCATGG 0: 1
1: 0
2: 0
3: 10
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1164736997 Original CRISPR AACTGCTTGTAGAAGTCTGA TGG (reversed) Exonic
901549533 1:9985495-9985517 AACAGTTTGTGGTAGTCTGATGG + Exonic
905293493 1:36939461-36939483 AACTGCATGCAGAAGGCAGACGG + Intronic
906119743 1:43381435-43381457 AACAGTTTATAGGAGTCTGAGGG + Intergenic
906255914 1:44350044-44350066 CCTTGCTTGTAGAAGACTGATGG - Intronic
915783334 1:158578945-158578967 AAATGCTTTTAGAAGAATGATGG - Exonic
916066126 1:161137144-161137166 AACAGCCTGTAGAAGGTTGAAGG + Intergenic
917680489 1:177361205-177361227 AACTCGTTGTATAACTCTGATGG + Intergenic
917867302 1:179209338-179209360 GACAGCGTGTAGAAGTCTGATGG - Intronic
918374231 1:183892709-183892731 ACCTGCTTCTAGAAATATGAAGG + Intronic
919209347 1:194458170-194458192 AACTGCTTGTGGAAGTGTTGAGG + Intergenic
920766600 1:208839650-208839672 AACTGCTTGGAGAATACTCAGGG - Intergenic
921176564 1:212600212-212600234 GACTGCTGGTAGAGGGCTGAGGG - Intronic
921191012 1:212708742-212708764 AACTGCCTGTGGAAGTTGGATGG - Intergenic
922167989 1:223131515-223131537 AAGTGCATGTAGAATTCTCATGG - Intronic
922280190 1:224115707-224115729 CACTGTTTGTAAAAATCTGAAGG - Intronic
924235853 1:241999095-241999117 AACTGCCTGCAGGAGCCTGAAGG + Intergenic
924281409 1:242440850-242440872 ACCTGATTTTAGAAGTGTGAAGG - Intronic
924826279 1:247542366-247542388 AACTCCTTGTAGAATACTGGTGG + Intronic
1063280359 10:4622413-4622435 AAATGCTTTTAGAAGTAGGAAGG - Intergenic
1063903331 10:10758355-10758377 AATTCCTTATAGAACTCTGAAGG - Intergenic
1065783455 10:29191627-29191649 ATCTGCTTGTTGCAGTCAGAGGG + Intergenic
1065902949 10:30224435-30224457 AACTGCCTGGAGAAGTCAAAAGG - Intergenic
1068253560 10:54476718-54476740 AAAGGTTTCTAGAAGTCTGAAGG - Intronic
1069348245 10:67495393-67495415 AAATGCTTCTAGGAGTCTTAGGG - Intronic
1069629076 10:69886926-69886948 AACTGCTAGGAGAAGCCTGCTGG + Intronic
1077649803 11:3960085-3960107 TGCTGCATGTAGAAGTTTGATGG + Intronic
1078261016 11:9708865-9708887 AACTGCTTGTAGAACTCAGTAGG - Intronic
1082193487 11:49274248-49274270 AGCTGCTTGGAGAAGTGTCAGGG - Intergenic
1085370912 11:76004374-76004396 AACCGCATGTAGAAGACAGAAGG - Intronic
1085961041 11:81462193-81462215 ATCTGCTTGAAGCTGTCTGAGGG + Intergenic
1086301837 11:85434767-85434789 AACTGTTTGGAATAGTCTGAGGG - Intronic
1086992416 11:93318495-93318517 AACTGTTAATAGAAGCCTGATGG + Intergenic
1089851361 11:121499504-121499526 ATCTGCCTGTAGAAGGCTCAGGG - Intronic
1090329185 11:125916952-125916974 AAGTGCTTGAAGAAGAGTGATGG + Intronic
1094862138 12:34479645-34479667 AAGTGTTTGTAGTACTCTGATGG - Intergenic
1097343594 12:58467005-58467027 AACTGCTTGTAGGGGTCTGGAGG + Intergenic
1097481367 12:60129899-60129921 AACTCCTTGCAGACGTCTAAAGG - Intergenic
1100213381 12:92421694-92421716 AACTCCTGGTTTAAGTCTGAAGG - Intronic
1100527700 12:95435289-95435311 AGATGCTTGAAGAAGTCTGTTGG - Intergenic
1101140201 12:101787974-101787996 AAGTGTTTTTAAAAGTCTGATGG + Intronic
1104811832 12:131624059-131624081 ACCTGCTTGGAGAAGTCAGTCGG - Intergenic
1105601480 13:21892228-21892250 AGCTGCTTCCAGAAGCCTGAAGG - Intergenic
1109479287 13:62928158-62928180 AACTGCTTGTAGAATTGGCAGGG + Intergenic
1109905911 13:68841636-68841658 AAATGTTCGTAGAAGTCTCAAGG - Intergenic
1114925493 14:27392268-27392290 GACTACTTGTAGGAGTGTGAAGG + Intergenic
1115853553 14:37606132-37606154 AGGTGCTTGAAGAAGTCTGGAGG + Intronic
1116432469 14:44862736-44862758 TACTCCTTGTAGAACTCTGTCGG + Intergenic
1117262165 14:54046926-54046948 AACTGCTGGGAGATTTCTGAGGG - Intergenic
1117683318 14:58227614-58227636 AACTGGTGGAAGAAGTCTGCAGG + Intronic
1119138795 14:72245746-72245768 AACTGCTTCTTCAAGTCTGTTGG - Intronic
1123958009 15:25360481-25360503 AACTGCTTCTTCAAGTCTGCAGG + Exonic
1126525877 15:49653694-49653716 AATAGCTTGTAGATGTCTTAAGG + Exonic
1130665450 15:85865467-85865489 AACTGCTTATAAAGGTCTTAGGG + Intergenic
1131753556 15:95536509-95536531 AAGTGCTTGAAGCAGCCTGATGG + Intergenic
1132811722 16:1802523-1802545 AGCTGCTTCTGAAAGTCTGATGG + Intronic
1138626375 16:58255191-58255213 AGCTGCTGGTACAAGTCCGAGGG + Intronic
1142186249 16:88696039-88696061 AACTGCCTGTAGTTCTCTGAGGG - Intergenic
1146228388 17:31087714-31087736 AGCTGCTTGAAGAAGTATCAGGG + Intergenic
1148995590 17:51706635-51706657 CCCTGCTTGAAGATGTCTGATGG + Intronic
1150886748 17:69095480-69095502 AATTTCTTGTAGAAGTCAGTGGG + Intronic
1152976130 18:220511-220533 TGCTGCTGGTAGGAGTCTGATGG - Intronic
1155274420 18:24172325-24172347 AACTGCTTGATGAAAACTGAAGG + Intronic
1155460188 18:26071074-26071096 AAATGGTTGGAAAAGTCTGAAGG + Intronic
1156966514 18:43100685-43100707 AACTGGATGTGGAAGTATGAAGG + Intronic
1157663143 18:49463244-49463266 AACTGCCTGCAGAAGTATGATGG + Intergenic
1159307693 18:66666525-66666547 ATTTGCCTGTAGAAATCTGAGGG - Intergenic
1163332242 19:16647256-16647278 AACAGCCTGGAGAAGTCAGAGGG + Exonic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
1166563984 19:43752362-43752384 AACTGTTTGTAGAACTCAGTGGG + Intronic
927007790 2:18868141-18868163 AATTTCCTTTAGAAGTCTGATGG + Intergenic
927668504 2:25049107-25049129 AACTGCTAGTAGGAGTATAATGG - Intronic
929431079 2:41887097-41887119 AACTGGTTAGAGAAGTCTTAGGG + Intergenic
930348220 2:50213800-50213822 AACTTCTTGTTCAACTCTGAAGG + Intronic
931758746 2:65397576-65397598 AACAGATTGTAGAAATGTGAAGG - Intronic
932400488 2:71477527-71477549 ACCTGCTTACAGAAGGCTGATGG + Intronic
937260497 2:120583340-120583362 AACTGCCTTCAGAACTCTGAGGG - Intergenic
937646815 2:124274852-124274874 AGCTGCTTAAAGAAGTCAGATGG - Intronic
942098734 2:172557260-172557282 AACAGCTTGTAAAAGTTTTATGG - Intronic
943404271 2:187460694-187460716 AGTTGAATGTAGAAGTCTGAGGG - Intergenic
943478023 2:188383798-188383820 AACTGATAGAAGAATTCTGATGG + Exonic
943499837 2:188673892-188673914 AACTGCTACTAGAAGTTAGAAGG - Intergenic
945485144 2:210386601-210386623 AAATGTTTGTAAAATTCTGAAGG + Intergenic
948670493 2:239565428-239565450 GAAGGCATGTAGAAGTCTGAAGG + Intergenic
1168734328 20:116787-116809 ACCTGCTGGTAGAAGTGTGTAGG + Intergenic
1177110646 21:17023679-17023701 AACTGCCTGTAGAGGGTTGAAGG - Intergenic
1178057666 21:28817670-28817692 AACTGCTAATAAATGTCTGATGG + Intergenic
1178186955 21:30233381-30233403 AACTTCTTGTAAAAGTCAGTAGG + Intergenic
1181767268 22:25100825-25100847 AAGTGCCTGTTGAAGTCAGAAGG + Intronic
1185260484 22:49859084-49859106 AACAGCATGTGGAGGTCTGATGG - Intronic
949743682 3:7264368-7264390 AACTGCTTGGAGAAGTGGTAGGG - Intronic
949908333 3:8878124-8878146 AGATGCTGGTAGAAGTCTGTCGG + Exonic
950094905 3:10323387-10323409 AACTGCGTATGGAAGTCAGATGG + Intergenic
950949862 3:16986741-16986763 AACTGCTTTTAAAACTCTAATGG + Intronic
957157345 3:76561948-76561970 AACTTCATATAGAAGTCTGCTGG + Intronic
958912972 3:100015577-100015599 CATTGCTTCTAGAATTCTGATGG + Intronic
959044493 3:101457636-101457658 AACTGCTCGTAGAAGGAAGAAGG - Intronic
959167165 3:102794774-102794796 AGCTGCTTTTAAAAGTCTAAGGG + Intergenic
968348444 3:198031592-198031614 AAATGCTTTCAGAATTCTGATGG - Intronic
971025454 4:22584851-22584873 TTCTTCTTGTAGACGTCTGAAGG + Intergenic
975033138 4:69648842-69648864 AACTGCTGGTAGCAGTCTTAAGG + Intronic
977772101 4:100871504-100871526 TTCTGCCAGTAGAAGTCTGAGGG - Intronic
986406310 5:7428148-7428170 AACTGCTGGTAGCAGGTTGATGG + Intronic
986598840 5:9450995-9451017 AAAGGCTTGTATAACTCTGAAGG + Intronic
988328700 5:29806193-29806215 TATTTCTTGTTGAAGTCTGAAGG - Intergenic
989115012 5:37943952-37943974 ATCTGCTTGTAGGTGTCTAAAGG + Intergenic
991280133 5:64904089-64904111 AACTGTTTGTAGAAGCATGGTGG - Intronic
994925955 5:106117652-106117674 AATTGCTTGTATAATTCTGTTGG - Intergenic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
998687379 5:144543905-144543927 AACTCCTTGTGGAAATCAGAAGG + Intergenic
1003044885 6:2724587-2724609 AACTGATCATAAAAGTCTGAAGG - Intronic
1009408996 6:63343804-63343826 AACTGCTTTTAAAAGGCTCATGG - Intergenic
1015867918 6:137746294-137746316 AAATGTTTTTAGAAGTCAGAAGG + Intergenic
1022703703 7:32784257-32784279 AATTCCTTGTAGCAGCCTGATGG - Intergenic
1022907943 7:34874382-34874404 AATTCCTTGTAGCAGCCTGATGG - Intronic
1026798718 7:73383459-73383481 AACTCCTTGTAGATGTATGTTGG - Intergenic
1028346997 7:89795396-89795418 AGCTGCTTGCAGTAGTCTGAGGG + Intergenic
1030521309 7:110601537-110601559 CACTGCTTCTAGAAGTCTTTTGG + Intergenic
1030807749 7:113937479-113937501 AGCTGCTTAGAGAAGTCTTAGGG - Intronic
1033138143 7:138801667-138801689 AAATGCTTGAAGAAGTTTGGAGG + Intronic
1037884279 8:22588249-22588271 AACTGCTGGTAGCAGCCTGGTGG + Intronic
1046371249 8:113309797-113309819 AACAGCATGGAGAAGACTGAGGG - Intronic
1048038218 8:130698358-130698380 AACTGGTTGAAGAACTATGATGG - Intergenic
1052104855 9:24500679-24500701 AACTGCTTATTGAAATCAGAGGG + Intergenic
1056091065 9:83206814-83206836 AACAGCTTCTGGAAGCCTGAAGG - Intergenic
1056856281 9:90132274-90132296 AACTGCCGGTGGAAGTATGAGGG - Intergenic
1057973726 9:99581636-99581658 ACTTGCTTGTAGAAGACAGAAGG + Intergenic
1058175902 9:101737185-101737207 AACGGCTTGGTAAAGTCTGAGGG - Intronic
1059969700 9:119652820-119652842 AACTGCATGGACCAGTCTGAGGG + Intergenic
1187075499 X:15930273-15930295 CACTGCTTGTAGTAGTCGGCTGG - Intergenic
1189470861 X:41313022-41313044 AGCTACTTGTAGCAGTCTGGTGG + Intergenic
1193805919 X:85994344-85994366 AATTGCTTGCAGAAGTGTGCTGG - Intronic
1196697619 X:118630381-118630403 TACTCCTTGTAGAACTCTGTCGG - Exonic
1199772012 X:150981137-150981159 AACTGCTTGTAGAAGGAGCAGGG + Intronic
1199786727 X:151112650-151112672 AACTGCTTGGAGAAGTGGTAGGG - Intergenic
1200886658 Y:8278584-8278606 TACTGTATGTAGAAGTCTGGGGG - Intergenic